Как сделать из бумаги объемный гриб: Мухомор из бумаги — как сделать объемный гриб

Содержание

Как сделать объемный гриб

Цель: изготовление муляжей грибов своими руками.
Задачи:
— вызвать интерес к изготовлению грибов в данной технике;
— развивать творческие способности

Я родился в день дождливый
Под осиной молодой,
Круглый, гладенький, красивый,
С ножкой толстой и прямой (гриб)

Чего только нет в магазине игрушек! А вот грибы приобрести проблема. А значит, их надо сделать своими руками. Попробуем.
Для работы необходимо:
• Листы картона
• Гуашь
• Кисть
• Ножницы
• Вата
• Длинные гвозди
• Крахмал
• Чай в пакетиках
• Универсальный лак по дереву

Давайте-ка, ребятки,
Отгадывать загадки!
Об интересных господах
В красивых модных шляпах,
Которые живут в лесах
И любят хвойный запах!

Посмотри, какой хороший!
Шляпа красная в горошек,
Кружевной воротничок —
Он в лесу не новичок! (мухомор)

Крепкий, плотный, очень статный,
В шляпе бурой и нарядной.
Это гордость всех лесов!
Настоящий царь грибов! (белый гриб)

Не спорю – не белый,
Я, братцы, попроще.
Расту я обычно
В берёзовой роще (подберёзовик)

Белый столбик под осинкой,
Да бочок от апельсинки.
А возьмёшь не аккуратно
И следов оставишь пятна (подосиновик)

Грибы можно использовать для рассматривания с детьми, определяя части гриба, называя цвет шляпки, познакомить с названиями. Дать понятия «съедобные» — «несъедобные грибы».Можно использовать, как часть НОД или развлечения, в качестве игрового упражнения «Собери грибы», «Найди лишний гриб».

Детям дошкольного возраста обязательно понравится бумажный грибочек, тем более что сделать его совсем не сложно.
Обычно грибы относят к осенним поделкам, а у нас он вполне себе разносезонный, так как включает яркие цвета и сочные зеленые расцветки. Но гриб из бумаги выполненный в подобной технике может быть приурочен и к осенним поделкам, если, например, сменить цвета. Причем достаточно прикрепить к грибочку кленовый лист не зеленый, а желтый. Еще лучше – натуральный, сухой листик.

Что понадобится для поделки?

  • Белый картон для ножки гриба. У меня он с одной стороны белый, а с другой – цветной, но это не столь важно, так как видно вторую сторону не будет;
  • Оранжевая и зеленая цветная бумага;
  • Ножницы, клей, карандаш, линейка;
  • Шаблон кленового листика. При отсутствии художественных навыков, листочек можно распечатать в интернете, либо попросту перерисовать его, приложив к монитору или картинке в книге не очень толстую белую бумагу.

Мастерим красивый гриб из бумаги

Сверните белый картон в трубочку и склейте края. Клей-карандаш бывает слабый для картона, поэтому лучшим вариантом будет ПВА.

Вырежьте из оранжевой цветной бумаги круг, найдите серединку и проведите радиус, отступите несколько сантиметров и проведите еще один. Сделайте вырез. Все значения определяются в зависимости от величины гриба. Но надо помнить, что чем больше сантиметров между радиусами, тем тоньше будет шляпка. А так как колпак на грибе нам был не нужен, я отступила где-то 2 см.

Подготовьте следующую деталь для гриба из бумаги. Вымеряйте ножку гриба, определите высоту будущей травы и вырежьте по этим параметрам прямоугольник из зеленой бумаги. Расчертите, как показано на фото, толщина травки может быть разная, у меня 1,5 см. разрежьте на полоски.

Из зеленой бумаги вырежьте по шаблону листик (либо используйте сухой), и участок полянки – некоторый неровный овал или другую неопределенную фигуру.

Теперь у нас все составляющие гриба готовы, пора приступать к сборке.

Приклейте травку на одну сторону ножки гриба, помогите ей красиво выгибаться в стороны. Если нужно, подрежьте длину.

Склейте шляпку, прикрепите к ней листик, а после шляпку приклейте к ножке. Если просто нанести клей на верхний конец ножки гриба, шляпка закрепится недостаточно сильно. Если нужна более устойчивая конструкция, прикрепить ее можно суперклеем, скотчем. Либо разрезать кончики рулона, отогнуть их наружу и уже к ним клеить шляпку.

Все, поделка гриба из бумаги готова.

Грибочек под осенним деревом. В этом дуэте зеленый лист на грибе просто просится быть в натуральном, сухом состоянии, или в желтом цвете.

Хочу показать вам наши замечательные грибы. Я очень люблю собирать грибы, но делать это можно не круглый год, а их красота недолговечна. Поэтому весной пришлось сделать их самой, с помощью дочки, разумеется.

Ребенок изучил несколько видов грибов, выбирала сама, какой вид будет делать, научилась их лепить, делать имитацию земли.

Это прекрасный счетный материал в пределах десятка и больше, собираюсь ими дачу украсить, сделаю композицию. Еще можно раскидать по поляне, а для детей организовать конкурс «найди грибочек», кто быстрее и больше.

Грибы можно ронять, швырять, кидать, они очень прочные и достаточно легкие. Да и просто — хотели и сделали, потому что это забавно!

Для работы нам будет нужно:

  • картон в форме круга,
  • краски-кисти,
  • гвозди (можно очень толстую проволоку, если нет гвоздей),
  • вата,
  • крахмал и вода для клейстера,
  • заварка или мак, для имитации земли.

Вырезаем кружочки, это заготовка для будущей шляпки. Мы сделали несколько видов — и маленькие, и средние, и большие (от 4 до 8 см).

Протыкаем гвоздем картон. Гвоздь, чем больше, тем лучше, крепче.

Это будет основа для ножки гриба. Но у нас были и маленькие гвоздики, для небольших грибочков. Протыкаем гвоздем картонную заготовку. Готово!

Итак, отложили заготовки в сторону. Займемся приготовлением волшебного клея.

Рецепт клейстера очень прост:

Вскипятите 1 литр воды. Разбавьте в стакане холодной воды 4-5 столовых ложек картофельного крахмала, хорошенько размешайте и влейте в кипящую воду тонкой струйкой. Все очень просто!

После этого будущий грибок обмазываем клейстером, сначала шляпку, потом ножку. Прикладываем вату и формируем (лепим) гриб: я начинала со шляпки, сделала шарик, обмакнула его в клейстер, приклеила, пригладила и затем снова добавляла вату, смазывая клейстером каждый новый слой.

Это самая сложная часть работы. У меня получалось очень много клея на вате, приходилось его отжимать даже.

Но это того стоило! Результат потом был фантастически красив! В общем, чем больше в грибе клейстера, тем он дольше сохнет, но тем он прочнее!

После этого оставляем грибы сохнуть. (У нас это происходило на батарее, но можно и естественным путем, просто будет чуть дольше) После того, как грибочек высохнет, он станет крепким, но очень легким.

Приступаем к покраске. Я открыла красивые грибные картинки для вдохновения и начала красить, дочка с радостью помогала. Вот ее самостоятельный грибочек.

Красили акриловыми красками (можно и гуашью).

После покраски еще разок сушим, обмакиваем ножку в клей (я достала ПВА, просто доверяю его прочности) и присыпаем чаинки и мак.

Имитация земли! Получается очень похоже, правда? Мне казалось, это быстро облетит, но ненужные чаинки просто не приклеились, а нужные довольно прочно приросли к грибочку.

Поделка понравилась, не сиюминутное это занятие, но делали в удовольствие!

Объемная аппликация «Мухомор» из цветной бумаги

Автор Наталья Котова На чтение 2 мин Просмотров 591 Опубликовано

Объемная аппликация «Мухомор» из цветной бумаги немного окунет нас в атмосферу прохладной осени. Где-то на опушке леса, в окружении опадающей листвы, встречает первые сентябрьские дождики грибочек. И пусть он совсем не съедобный, зато яркий и красивый.

Для создания объемной аппликации с мухомором приготовим:

  • бумагу цветную
  • линейку с клеем
  • простой карандаш с ножницами

Пошаговый мастер-класс по изготовлению мухомора из цветной бумаги

1. Сначала сделаем заготовки для шляпки нашего будущего гриба. Это будут квадраты со стороной 10 см, вырезанные из красной бумаги. Нам достаточно вырезать 4 заготовки.

2. Теперь каждый из квадратов требуется свернуть в кулечек. Для этого смазываем клеем одну сторону квадрата, а потом сворачиваем заготовку.

3. У получившегося кулечка требуется срезать выступающий уголок.

4. Таким способом готовим 4 заготовки для шляпки нашего мухомора.

5. Ножку вырежем из белой бумаги в виде вытянутой узкой восьмерки. Приклеиваем ее на лист зеленой бумаги.

6. Теперь сверху добавляем шляпку гриба, которая будет состоять из четырех красных заготовок.

7. Для мухомора характерна своеобразная «юбочка», расположенная на ножке. Ее делаем из полоски белой бумаги 12х3 см, сложенной в виде «гармошки». Приклеиваем получившуюся заготовку сразу под шляпкой гриба.

8. Дополнительно из белой бумаги вырежем несколько кружков и приклеим их на шляпке.

9. Осталось вырезать несколько листочков из бумаги. Для этого мы используем основные оттенки осени – желтый, зеленый и оранжевый.

10. Один из листочков приклеим на шляпку, а остальные разместим в нижней части поделки. Такая объемная аппликация «Мухомор» из цветной бумаги получилась.

Мухомор из цветной бумаги можно сделать даже с детками детсадовского возраста. Поделка для начинающих сможет познакомить не только с интересным вариантом аппликации, но и с окружающим миром. Например, можно приурочить ее к беседе о временах года, разнообразии растений и пр. А теперь, продолжив тему осени, можно сделать зонтик своими руками.

шаблоны для детей с фото. Учимся, как сделать гриб своими руками из бумаги, пластилина, картона, в виде аппликации

Грибы занимают особое место среди представителей живой природы. Разнообразие их видов можно наблюдать в различных формах и окраске. Детей необходимо знакомить с ними в процессе изготовления поделок, не только для общего и эстетического развития, но также чтобы научить отличать съедобные от ядовитых.

Для этого достаточно выбрать одно из многих привлекательных фото поделки гриб и приступить к изготовлению такого же изделия своими руками.

Простейшая поделка из бумаги

Для маленьких детей будет интересно сделать в садик простой и симпатичный бумажный грибок. Такое изделие можно привязать, как к летнему сезону, так и к осеннему, если это условие входит в состав домашнего задания.

При этом можно использовать листья разной расцветки, оформляя композицию. Яркие, сочные цвета и зеленую травку можно применить к летней теме. Для работы понадобятся следующие материалы:

  • Ножницы, карандаш, клей для бумаги (ПВА) и линейка.
  • Кусочек картона для ножки. Если он не подходит по цвету, то его можно покрасить или обклеить в нужный тон.
  • Набор цветной бумаги.
  • Характерный, красивый лист дуба, клена или другого дерева можно собрать на природе и высушить.
  • Если нет заготовленного гербария, то его также можно вырезать из цветной бумаги, пересняв шаблон из книги или с экрана монитора.

Ход работы:

  1. С помощью линейки и карандаша надо вычертить прямоугольник для ножки на картоне, а затем вырезать его и склеить короткие стороны с помощью ПВА.
  2. Из коричневой, красной или оранжевой бумаги надо вырезать кружок, а затем начертить на нем небольшой сегмент, ограниченный двумя радиусами.
  3. Это пригодится для создания выпуклой шляпки поделки на тему «грибы», которая приклеивается на ножку.
  4. Расстояние между сторонами сегмента должно быть небольшим, не более 1-2 см, в зависимости от величины изделия, чтобы не получился треугольный колпак.
  5. Шляпку из красной бумаги можно обклеить кусочками белой бумаги, имитируя мухомор.
  6. Для полоски травы надо отмерить меньший прямоугольник, который будет по высоте ниже ножки и вырезать его из зеленой бумаги.
  7. Отдельные стебли получаются при разрезании полоски с верхней стороны.
  8. Нижний край травки приклеивается к основанию гриба, а вся композиция устанавливается на лист дерева, который можно приклеить к овальному куску картонного основания.
  9. Небольшой листик можно прикрепить также на шляпку гриба.

Изделие из пластилина

Пластилин для изготовления поделки грибы своими руками, представляет собой удобный и пластичный материал.

  1. Достаточно скатать колбаску из белого или коричневого пластилина и придать ей форму сужения кверху, как можно считать ножку готовой.
  2. Для шляпки делается заготовка из шарика фиолетового, оранжевого, коричневого или красного цвета, которая затем превращается в круглую шляпку того вида гриба, который был задуман.
  3. Из тонкой полоски зеленого пластилина, с нарезанным в бахрому верхним краем, можно сделать травку, прикрепленную к низу ножки.
  4. Из кусочка пластилина делается лепешка неправильной формы, к которой крепятся один или несколько грибков.
  5. Также вся композиция украшается листиками зеленого или желтого цвета.
  6. На внутренней стороне шляпы можно изобразить пластины, сделав зубочисткой бороздки.

Интересно смотрятся изделия из пластилина с использованием природных материалов, таких как скорлупа орехов, желуди и каштаны.

Грибы из подручных материалов

Быстро и увлекательно можно изготовить поделку грибы для сада из мелких бытовых предметов.

  1. Можно использовать картонный валик, оставшийся от рулона бумаги и одноразовую тарелку.
  2. На круглой тарелке надо вырезать небольшой сегмент, чтобы сделать шляпку немного выпуклой, а затем приклеить ее на ножку.
  3. Низ можно покрасить в коричневый цвет, а шляпку в красный.
  4. Затем на нее наклеиваются кружочки белой ваты и мухомор готов. Его можно закрепить на более широкой подставке для устойчивости.
  5. Для декоративной веревки-гирлянды, на которую подвешивают в детском саду рисунки для высыхания, можно изготовить грибки из прищепок.
  6. Для этого небольшие кусочки толстой красной ткани надо приклеить на те части прищепок, за которые берутся для того, чтобы их открыть.
  7. Белые точки делают с помощью пришитых бусинок или пуговиц.

Аппликации из продуктов и других материалов

Для того, чтобы изготовить детскую поделку гриб, можно пользоваться различными материалами из тех, что находятся в каждом доме.

  1. Лист картона можно покрасить в зеленый цвет и сделать рамку из макарон.
  2. В середине расположить грибы, шляпки которых сделать из гречки, приклеенной по контуру рисунка, а ножки из рисовой крупы.
  3. После высыхания клея, крупы можно оставить в их натуральных цветах или покрасить в другие тона.
  4. Можно сделать интересные ажурные грибы из салфеток или гофрированной бумаги, приклеивая их к толстому листу основы.
  5. Достаточно прочными и долговечными могут оказаться изделия из соленого теста.
  6. Существует несколько способов, как сделать поделку грибы из этого привлекательного материала.
  7. Одним из них является изготовление грибов на основе, в качестве которой можно использовать катушку или лампочку, так как объемные изделия при высыхании трескаются.
  8. Лампочку следует покрыть слоем соленого теста, а на ее узкую часть одеть картонную шляпку.
  9. В нижней части ножки можно продавить полоски травы, пока она не высохла. Когда тесто станет сухим, поделку следует раскрасить.

Грибочки из гипсового раствора

Дети постарше могут успешно изготовить поделку гриб мухомор из гипса. Обычным приемом работы с этим материалом является отливка в подготовленные формы.

  1. Для ножки можно вырезать нужный фрагмент из середины пластиковой бутылки, скрутить его в цилиндр и закрепить форму скотчем.
  2. Формой для шляпки может послужить любая подходящая мисочка или половинка мячика.
  3. Сначала надо залить раствор в форму для ножки, а когда она будет готова, можно залить форму шляпки и сразу установить в нее отлитую деталь.
  4. Таким образом, они сразу будут надежно закреплены.
  5. Если застелить формочку для шляпки пищевой пленкой, то на поверхности получится оригинальная фактура живого гриба.
  6. Когда все изделие застынет, его необходимо зачистить мелкой наждачной бумагой, а затем раскрасить в разные цвета.

Фото поделок гриб

Общие сведения о субстратах для грибов — грибы FreshCap

Использование соломы в качестве субстрата

Солома — дешевый и чрезвычайно эффективный субстрат, который хорошо подходит для многих видов грибов. Солома — это часть стебля. таких зерен, как пшеница, ячмень или овес — это в основном то, что остается после удаления самого зерна.

Во многих отношениях солома является отходами сельского хозяйства.

Если вы живете недалеко от фермерского поселения, у вас не должно возникнуть проблем с поиском соломы.Квадратный залог в 40 фунтов (сухой вес) должен стоить не более 2-4 долларов. Имейте в виду, что солома грязная при работе — ее необходимо измельчить, очистить и пастеризовать перед использованием в качестве субстрата. Он лучше всего подходит для средних и крупных операций по выращиванию, где есть отдельная зона подготовки и большой барабан для пастеризации.

Квадратный тюк из спрессованной соломы 40 фунтов.

Тем не менее, вы все еще можете использовать солому для выращивания в домашних условиях в масштабе хобби. Меньшее количество соломы можно измельчить садовыми ножницами и пастеризовать, налив горячей воды в емкость вместо использования большого барабана и газовой горелки.

Если вы планируете выращивать мелкие растения с использованием соломы, вы можете рассмотреть возможность использования EZ Straw . Это особенно удобно, если вы не живете рядом с фермерским поселением. В них продается крупно нарезанная солома в удобном пакете, уже предварительно нарезанная и очищенная. Использование чего-то вроде EZ Straw предотвратит беспорядок и хлопоты при работе с большими тюками соломы.

Использование опилок и щепы твердых пород

Опилки твердых пород древесины являются отличным субстратом для грибов и обычно используются в промышленности.Это отходы деревообрабатывающей промышленности, и в зависимости от вашего местоположения их можно дешево и легко найти.

Мелкие опилки обычно смешиваются с древесной стружкой, что, по-видимому, способствует более быстрой колонизации субстрата и обеспечивает лучшую структуру для удержания мицелия.

Обычно используемые лиственные породы — это дуб, клен, бук и гикори или смесь нескольких пород. Хвойные породы, такие как ель, сосна и пихта, не подходят для выращивания грибов.

Если вы находитесь в районе, где затруднен доступ к опилкам твердых пород, вы всегда можете использовать пеллеты из твердых пород древесины.Они обычно используются для дровяных печей, но также хорошо подходят для выращивания грибов! Гранулы необходимо замочить в воде, прежде чем они станут мелкими опилками. Замачивание в воде также поможет увлажнить субстрат.

Обычно гранулы можно найти недорого, хотя в большинстве розничных магазинов они могут быть доступны только в сезон. Их большой выбор. здесь .

Обычно они поставляются в больших 40-фунтовых мешках, в которых должно хватить опилок для большинства небольших хобби.Опять же, убедитесь, что гранулы сделаны из твердой, а не из мягкой древесины. Вы также должны убедиться, что гранулы не содержат много клея, красок или других добавок.

Если вы выращиваете грибы с использованием гранул из опилок, следующий рецепт субстрата хорошо подходит для многих видов изысканных грибов:

На каждые 5 фунтов плодоношения:

  • 5 стаканов гранул из твердых пород древесины
  • 1,4 литра воды
  • 1-1 / 4 стакана пшеничных отрубей

Для получения дополнительной информации ознакомьтесь с нашей статьей о выращивании грибов на блоках для плодоношения из опилок .

Добавка

Субстраты для грибов могут быть усилены добавлением легко потребляемой и очень питательной добавки, которую грибной мицелий может использовать для более быстрого и сильного роста.

Добавка также даст больший урожай! Однако будьте осторожны, так как слишком большое количество добавок может привести к более высокому уровню заражения.

Обычно добавка достигается путем добавления отрубей (овсяных или пшеничных) в соотношении 5-10% от сухого веса. Добавленные субстраты абсолютно необходимо полностью стерилизовать, иначе загрязнители быстро примут верх.

Даже после полной стерилизации вероятность заражения растет линейно с увеличением количества добавок, и в конечном итоге вы достигнете точки убывающей отдачи.

Интересно, что грибы шиитаке требуют меньшего количества добавок для достижения наилучших результатов. Избыточные добавки грибов шиитаке могут давать странные и непродаваемые мутировавшие плодовые тела.

Шиитаке, естественно растущий на бревнах лиственных пород.

The Masters Mix

Если вы ищете чрезвычайно эффективный субстрат для выращивания устриц, вы можете попробовать то, что известно как Master’s Mix — смесь опилок и соевой лузги в соотношении 50/50, стерилизованная в 15 фунтов на квадратный дюйм для 2.5 часов.

Первоначальным «мастером» этого микса является T.R. Дэвис из «Грибы земного ангела». Вы вряд ли найдете другой субстрат, который даст столько же урожая при первом смывании, как эта смесь.

Насколько я могу судить, у использования соевой шелухи есть два недостатка. Во-первых, второй флеш будет далеко не таким сильным, как первый, даже несмотря на то, что огромный первый флеш определенно компенсирует это.

Во-вторых, кажется, что смесь не заселяется так быстро, как более традиционная формула с добавками опилок.Возможно, это только на моем опыте, поэтому количество миль может отличаться.

Выращивание грибов на навозе

Большинство людей думает, что грибы растут на навозе, и это действительно так. Хотя большинство гурманов предпочитают опилки лиственных пород или солому, есть много распространенных видов, которые лучше всего растут на навозе.

Виды Agaricus, такие как шампиньон обыкновенный и гриб портобелла, а также многие виды псилоцибина являются хорошими примерами.

При коммерческом выращивании Agaricus bisporus навозный субстрат сначала проходит многодневную фазу компостирования, когда большие кучи компоста (навоз и солома) естественным образом нагреваются до 160 ° F, и полезные организмы размножаются.

По завершении этого процесса компост правильно пастеризуется для удаления всех нежелательных загрязнений. Этот процесс вторичной пастеризации также удаляет аммиак, который естественным образом накапливается во время компоста на первом этапе. Посмотрите это аккуратное видео ниже, в котором резюмируется процесс приготовления компоста для выращивания шампиньонов:

Выращивание грибов на компосте таким способом обычно не практикуется домашними производителями, хотя это, безусловно, возможно.

Выращивание грибов на кокосовом кокосовом волокне

Еще одним распространенным материалом, используемым для выращивания грибов в домашних условиях, является кокосовое волокно. Кокосовая койра — это натуральный материал, состоящий из шелухи и скорлупы кокосовых орехов.

Обычно используется для квазигидропонных систем выращивания растений. Он хорошо удерживает воду, и, хотя он не обеспечивает многих питательных веществ для растений, он достаточно питателен для выращивания грибов, хотя и не настолько, чтобы загрязнения легко размножались.

Кокосовое волокно часто смешивают в соотношении 1: 1 с вермикулитом для образования подходящего субстрата для грибов.Вермикулит — это вспученный минерал, который придает структуру субстрату и удерживает воду, хотя он питательно инертен. Смесь вермикулита кокосового волокна все еще должна быть должным образом пастеризована, прежде чем инокулировать грибную икру.

Вы можете купить прессованные блоки кокосового волокна на Amazon , а также обычно можете найти их в местном садовом центре. Кокосовое волокно увеличится во много раз, если его разломить и пропитать водой.

Выращивание грибов на кофе

Хотя в качестве субстрата для выращивания грибов можно использовать только отработанную кофейную гущу, обычно это не лучший выбор.Кофейная гуща богата азотом, который обеспечивает мицелий большим количеством энергии и способствует повышению урожайности. Однако такое богатство прямых кофейных субстратов повышает вероятность загрязнения.

Кофейную гущу лучше использовать в качестве добавки , добавляемой к другим материалам субстрата, таким как древесные опилки лиственных пород или кокосовое волокно. Перед добавлением в субстрат кофейную гущу следует полностью стерилизовать, но часто можно обойтись простой пастеризацией.

Использование отработанного субстрата для грибов

Если вы начнете выращивать много грибов, у вас скоро могут появиться большие кучи отработанного субстрата, с которыми вы не знаете, что делать.Сдвиговый объем субстрата может увеличиваться очень быстро, поэтому неплохо иметь представление, что со всем этим делать.

Самый очевидный выбор, если у вас достаточно небольшое количество использованного субстрата, — это его компостировать. Просто оставьте субстрат в кучу снаружи и позвольте естественному процессу разложения утихнуть. Велика вероятность, что вы даже можете получить дополнительный смыв грибов в своей компостной куче! Пройдет совсем немного времени, прежде чем израсходованный субстрат превратится в густой глинистый компост, который можно добавить в огород.

Также возможно, что субстрат можно повторно использовать для выращивания большего количества грибов. Например, если у вас есть куча использованных блоков шиитаке, вы можете разбить их, повторно стерилизовать и повторно использовать органический материал, чтобы вырастить больше шиитаке! Однако имейте в виду, что вам, вероятно, потребуется добавить добавки, и у вас, вероятно, будут урожаи с уменьшающейся отдачей.

Если у вас больше израсходованного субстрата, тогда вы знаете, что с ним делать, посмотрите, есть ли в вашем городе бесплатная программа компостирования или соседний фермер согласен позволить вам создать большую компостную кучу на своей земле.

Многие крупные коммерческие предприятия по выращиванию грибов фактически перерабатывают и продают использованный грибной субстрат в качестве фирменного компоста для садов.

Узнайте, что работает для вас

В конце концов, какой субстрат лучше для вас, будет зависеть от вашего местоположения, стиля выращивания и типа грибов, которые вы хотите выращивать.

Лучший способ научиться — экспериментировать с разными типами субстратов, разными методами подготовки и разными типами добавок.

Удачи!

Выращивание грибов — начало работы

Я никогда раньше не выращивал грибы. Как лучше всего начать?

Важно сначала выбрать легкий в выращивании вид, и следующие виды рекомендуются для новичков, исходя из их высокого уровня успешности, а также из-за того, что методы и материалы легко найти.

Грибы плодоносят, когда им не хватает места для колонизации, поэтому, когда они захватывают бревно, кучу мульчи, мешок пастеризованной пшеничной соломы или компостную грядку, они способны плодоносить.Вот основы, обратитесь к книге Tradd Cotter по органическому выращиванию грибов и книге Mycoremediation, чтобы получить опыт по деталям выращивания, чтобы улучшить и уточнить ваши результаты! Вы также можете посетить Университет Грибной горы, где вы найдете учебные пособия, которые помогут вам повысить свой уровень навыков по определенному стилю совершенствования.

Самое простое производство на открытом воздухе?

На открытом воздухе на бревнах — Шиитаке

Грибы шиитаке, выращенные на бревнах на открытом воздухе, являются одними из самых простых грибов для новичков в изучении циклов производства грибов.Хотя вешенки легче всего плодоносить, они подвержены насекомым, поэтому лучше всего начинать с шиитаке. Все бревенчатые грибы выращиваются на свежесрубленных бревнах, поэтому вам нужно будет разрезать несколько свежих бревен твердых пород, предпочтительно дуба (альтернативы см. В таблице деревьев), спиленных меньше месяца из живых здоровых деревьев, диаметром 6-10 дюймов. журналы лучше всего. В бревнах просверливаются отверстия на расстоянии 4-5 дюймов по всей покрытой корой поверхности и заполняются пробкой или опилками. Отросток опилок может заражать до 100 погонных футов древесины.Порождение вилки может заразить до 10 погонных футов древесины. Вставляется икры, заглушка забивается заподлицо с помощью молотка, а опилки вводятся (с помощью поршня или набиваются вручную). Воск растапливают в кувшине в горячей воде и смачивают маленькой щеткой, чтобы закрыть отверстия после того, как вставили икру. После того, как все дыры будут созданы и обработаны воском, вы закончите нерест! Периодически поливайте бревна, каждую неделю, если нет дождя, и через 8-10 месяцев грибы должны колонизироваться и начать плодоносить.

Шиитаке бывает трех типов: холодный (33-50), широкий диапазон (50-75) и теплый / горячий (75-100)

Создает все типы штаммов одновременно. Они будут плодоносить, когда наступит температурное окно ПОСЛЕ завершения первых 8-10 месяцев колонизации. Каждый штамм плодоносит дважды в год, и вы можете замачивать 10% каждого сорта каждую неделю, чтобы оптимизировать еженедельный урожай, и повторите после первого цикла. После того, как поленья плодоносят дважды за сезон, дайте им отдохнуть, накройте их брезентом, чтобы они высохли, и снова начните замачивание, когда наступит следующий сезон.

Вымачивание — Для замачивания бревен погрузите их в воду (колодец или город) на 12-24 часа, НЕ БОЛЬШЕ, они утонут.

Плодоношение — После замачивания посторонних бревен напротив деревьев или после того, как их сложите в виде бревенчатой ​​хижины, и через несколько дней должны появиться грибы, поливайте эти бревна дважды в день!

Сбор — Когда шляпки шиитаке сплющиваются, они созревают, и их можно скручивать и собирать.

Отдых для бревен — После уборки бревна могут отдыхать в течение 8-10 недель, их следует накрыть брезентом для просушки и их можно повторно замачивать во второй раз в год для повторной промывки, после чего их можно накрыть брезентом до следующего сезон.Бревна шиитаке могут сохнуть до года без воды и при этом оставаться живыми, поэтому поливайте их только тогда, когда вы хотите, чтобы они принесли плоды!

На открытом воздухе на древесной стружке — Царь строфария (Stropharia rugoso-annulata)

Царь строфария, также известный как садовый великан и винный колпак, представляет собой гриб, любящий щепу твердой древесины, который легко естественным образом растет в ландшафтной мульче и садах. Он не будет расти на хвойных деревьях, поэтому вам понадобится свежая древесная щепа грибов (со здоровых деревьев и срезанных в течение нескольких недель).

Для Короля Строфарии вам понадобится ПОРОШКА ОПИЛКИ, и это так же просто, как смешать измельченное икры со свежей древесной стружкой (это помогает сначала намочить щепу) и разложить икру и щепки в ландшафте между рядами овощей. или заправьте годичные кольца смесью на глубину 3-8 дюймов.
Король строфария плодоносит весной и осенью, если весной вы создадите свои чипсы, они будут плодоносить осенью.

На открытом воздухе на компосте из навоза — Миндаль Portabella (Agaricus subrufescens / A.blazei)

Миндаль Portabellas — двоюродные братья обыкновенной белой пуговицы и комплекса crimini / portabella. Интересно, что они — тропические родственники, которые предпочитают плодоносить при температуре 75-90F, любят компостированный навоз, что делает их идеальным кандидатом в качестве садовой добавки для промежуточного посева грибов на грядки или пропашные культуры.

Вам понадобится опилочная порода, которую можно крошить и смешивать с навозом, который затем можно превратить в почву или самостоятельно сделать грядкой.

Самое простое внутреннее производство?

Вешенки

Вешенки можно выращивать на различных отходах, включая отработанную кофейную гущу, переработанную бумагу, картон и даже хлопковую одежду.

Для вешенки на сыпучих средах вам понадобится опилочная порода. Самый простой способ начать — собирать использованную кофейную гущу (ежедневно на кухне или попросить местную кофейню спасти ее).Убедитесь, что они свежие и ежедневно собирайте их в собственном контейнере, так как кофейная гуща может легко заразиться зеленой плесенью конкурентов.

Контейнер — Используйте галлоновый контейнер с завинчивающейся крышкой или ведро на 5 галлонов с крышкой. Ежедневно добавляйте кофе и фильтруйте для личного использования, экономно посыпая опилками контейнер, как будто вы его солите. Если у вас есть большое количество кофе из кофейни, вылейте кофе в большую чистую ванну и смешайте 2 чашки сока на каждые 5 галлонов кофейных отходов в носитель.После перемешивания слейте кофе обратно в ведро для колонизации. Наполните ведро, но оставьте около 2 дюймов для развивающихся грибов.

Spawn run — Ежедневно наблюдайте за своим ведром, оно должно начать бледнеть и начать колонизацию, в конце концов, забрав весь объем кофе. Держите крышку слегка приоткрытой, чтобы она могла дышать, но не высыхала. Если он выглядит сухим, вода его смочить. Как только масса станет твердой и белой, она подумает о плодоношении. Молодые грибы сформируются через несколько недель, и вы можете опрыскивать их чистой водой, слегка открывая крышку каждый день, чтобы приспособиться к росту, так как они могут быть большими.Соберите урожай, когда они перестанут расти, верните крышку в исходное положение на две недели, затем налейте два стакана воды в ведро, чтобы увлажнить среду, и повторите этапы плодоношения. Плодоносит 2-3 раза, а может и больше!

Полное руководство по грибам львиной гривы

Питание

Hericium богат белком и витамином D. Фактически, грибы — единственный источник продуктов, которые содержат витамин D. Он также содержит приличное количество калия (около 6% на порцию) и железа (2%).

Лекарственные качества

В последние годы львиная грива наконец привлекла к себе больше внимания ученых, став звездой в исследованиях здоровья мозга и поддержки иммунитета . Он богат антиоксидантами и антибактериальными соединениями, которые могут помочь при проблемах с пищеварением и способствовать здоровому росту клеток.

Львиная грива исторически использовалась для лечения инфекций, диабета (помогает снизить уровень сахара в крови) и заживления ран. Гриб богат полисахаридами, в первую очередь бета-глюканом, которые в исследованиях продемонстрировали противоопухолевую активность и поддержку иммунной системы.

Когнитивные способности

Львиная грива, пожалуй, наиболее популярна из-за ее использования в качестве ноотропа или усилителя мозга. В настоящее время изучается его потенциал для лечения болезни Альцгеймера и других проблем, влияющих на когнитивные функции и нервную систему. Одно исследование показало, что у субъектов с легкими когнитивными нарушениями, которые ежедневно принимали порошок Hericium в течение четырех месяцев, наблюдалось значительное улучшение функции мозга.

Он производит два семейства соединений: эринацинов и гериценонов .Эти соединения важны для фактора роста нервов (NGF) , помогая в обучении и памяти . Hericium обладает удивительной способностью проходить через гематоэнцефалический барьер, стимулируя рост нейронов и защитных клеток. Это означает, что он может улучшить общую умственную работоспособность.

Широко распространено мнение, что популярный лечебный гриб помогает с концентрацией и вниманием, а также улучшает память. Этот мощный когнитивный усилитель также может помочь с настроением и психическим здоровьем.Многие люди, которые употребляют его регулярно, считают его отличным союзником для снятия стресса.

Новые исследования показывают, что Львиная грива может быть прекрасной альтернативой для лечения тревоги и депрессии . Он работает для поддержки нервов в гиппокампе, а не влияет на наши нейротрансмиттеры, как это делают обычные антидепрессанты.

Сливочно-жареный грибной суп — чертовски вкусно

Такой кремовый, насыщенный, сытный и успокаивающий! Секрет рецепта грибного супа заключается в том, чтобы сначала обжарить грибы в чесноке и свежем тимьяне!

Привет из Чикаго!

Здесь опускается ниже 30 градусов по Фаренгейту, и, помимо пиццы, которую я раздавил вчера вечером, мне действительно нужна тарелка этого грибного супа!

Это самый сливочный крем-суп с секретным ингредиентом: конечно же, жареными грибами!

Предварительное обжаривание грибов существенно меняет мир — они создают самые землистые, сытные, идеально приправленные грибы, какие только можно пожелать.

И если вам нравится более протертый суп, вы также можете приложить дополнительные усилия и использовать здесь погружной блендер, но я больше люблю крупный суп.

В любом случае, пожалуйста, приготовьте здесь весь хрустящий хлеб, чтобы впитать все грибное добро!

  • 2 фунта грибов кремини
  • 3 столовые ложки оливкового масла
  • 4 зубчика чеснока, измельченного и измельченного
  • 8 веточек свежего тимьяна, измельченного
  • Кошерная соль и свежемолотый черный перец по вкусу
  • 3 столовые ложки несоленого масла
  • 1 большой сладкий лук, нарезанный кубиками
  • ¼ стакана универсальной муки
  • ⅓ стакана белого сухого вина *
  • 5 стаканов куриного бульона
  • 2 лавровых листа
  • ⅓ стакана жирных сливок
  • Разогрейте духовку до 400 градусов F.Линия выпечки с пергаментной бумагой.

  • Выложите грибы одним слоем на подготовленный противень. Добавьте оливковое масло, половину чеснока и 4 веточки тимьяна; Добавить соль и перец по вкусу. Осторожно перемешайте.

  • Поместите в духовку и запекайте в течение 20-30 минут или до появления коричневой и мягкой корочки, размешивая. Дайте остыть перед крупной нарезкой; отложить.

  • Растопите масло в большой кастрюле или голландской духовке на среднем огне.Добавить лук и варить, постоянно помешивая, примерно 10-15 минут, пока он не станет золотистым и не станет карамелизированным. Вмешайте оставшийся чеснок примерно 1 минуту, пока он не станет ароматным.

  • Взбейте муку, пока она не подрумянится, около 1 минуты. Вмешайте вино, соскребая со дна кастрюли подрумяненные кусочки.

  • Добавьте куриный бульон, лавровый лист и оставшийся тимьян; Добавить соль и перец по вкусу. Довести до кипения; Уменьшите огонь и тушите, пока немного не уменьшится, около 15 минут.

  • Добавить грибы; варить на медленном огне до загустения, еще около 10-15 минут. Снять с огня; добавить жирные сливки.

  • Подавать немедленно.

* Дополнительный куриный бульон можно использовать для белого вина как безалкогольный заменитель.

Генетическое разнообразие Дахунцзюня, коммерчески важного «большого красного гриба» из Южного Китая

Аннотация

Фон

На юге Китая дикий эктомикоризный гриб, обычно называемый местными жителями «Дахунцзюнь» или «Большой красный гриб», в течение многих лет собирался, потреблялся и / или экспортировался в качестве экзотической пищи.Хотя этот гриб важен с экологической и экономической точки зрения, об этом грибе, в том числе о его разнообразии и структуре населения, известно очень мало.

Методология и основные выводы

В этом исследовании мы проанализировали 122 образца из пяти местных популяций, представляющих известные ареалы распространения этого гриба на юге Китая. Мы исследовали генетическое разнообразие и географическую структуру этого гриба, используя последовательности из четырех фрагментов ДНК. Наш анализ выявил, что этот гриб содержит по крайней мере три расходящиеся линии: один соответствует недавно описанному виду Russula griseocarnosa из южного Китая, а оставшиеся два, вероятно, представляют два новых вида.Хотя эти линии были четко структурированы географически на основе последовательностей ITS, доказательства древнего и / или недавнего потока генов были также идентифицированы внутри отдельных линий. Кроме того, местное население из Айлаошань в центральной провинции Юньнань, откуда прибыли 85 из наших 122 образцов, продемонстрировало явные доказательства рекомбинации.

Заключение и значение

Эктомикоризный гриб «Dahongjun» из южного Китая представляет собой комплекс видов, по крайней мере, с тремя расходящимися ветвями.Эти линии в значительной степени географически структурированы, и есть свидетельства рекомбинации в природе. Наши результаты показывают, что зрелые грибы Dahongjun с многочисленными базидиоспорами важны для воспроизводства этого гриба в природе, и что отдельные популяции этого вида должны управляться отдельно.

Образец цитирования: Li M, Liang J, Li Y, Feng B, Yang Z-L, James TY, et al. (2010) Генетическое разнообразие Дахунцзюня, коммерчески важного «большого красного гриба» из Южного Китая.PLoS ONE 5 (5):
e10684.

https://doi.org/10.1371/journal.pone.0010684

Редактор: Саймон Джоли, Университет Макгилла, Канада

Поступила: 14 июня 2009 г .; Одобрена: 19 апреля 2010 г .; Опубликовано: 18 мая 2010 г.

Авторские права: © 2010 Li et al. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Это исследование было поддержано Советом по естественным наукам и инженерным исследованиям Канады, премией Premiers Research Excellence Award, совместными фондами Национального фонда естественных наук Китая и правительства провинции Юньнань (№ U0836604), Национальным фондом фундаментальных исследований. Программа Китая (№ 2009CB522300) и Ключевая лаборатория биоразнообразия и биогеографии Китайской академии наук (№ 0806371111). Авторы подтверждают, что финансирующие агентства не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Грибы — важные составляющие глобальной биосферы. В лесных экосистемах многие грибы образуют симбиотические ассоциации с корнями растений, образуя структуру, называемую микоризой. Более 90% наземных растений образуют микоризные ассоциации с грибами. Эти грибы помогают растениям получать необходимые минералы и воду из почвы и могут способствовать устойчивости растений к болезням и засухе [1].Хотя большинство грибных материалов находятся под землей и обычно не наблюдаются невооруженным глазом, некоторые микоризные грибы, особенно относящиеся к Basidiomycota, легко заметны в определенное время года, поскольку они производят заметные плодовые тела (грибы). Некоторые из этих грибов собираются как источник экзотической и высоко ценимой пищи для людей.

Род грибов Russula (Russulaceae; Russulales; Agaricomycetes; Basidiomycota) представляет собой очень разнообразную группу эктомикоризных (EcM) грибов.На данный момент в мире идентифицировано и охарактеризовано около 750 видов этого рода [2]. Род считается важным как с экономической, так и с экологической точки зрения. Экологически они, как и грибы EcM, способствуют здоровому росту растений, доставляя воду и минералы, а также повышая устойчивость к стрессу. Взамен они получают углеводы из растений-хозяев. Этот симбиоз, вероятно, играет решающую роль в поддержании биоразнообразия и геохимических циклов в лесных экосистемах [3]. В типичных экосистемах Russula составляет значительную часть биомассы EcM, а его распространение варьируется от тропиков до субтропиков, регионов с умеренным климатом и даже арктических зон.Было показано, что Russula является одним из наиболее доминирующих EcM грибов в лесных сообществах EcM как по частоте, так и по численности [4]. С точки зрения съедобности только несколько видов Russula , например, из группы R. emetica и R. subnigricans Hongo, являются ядовитыми. Многие виды являются отличными источниками пищи для потребления человеком, включая R. cyanoxantha (Schaeff.) Fr., R. virescens (Schaeff.) Fr. и «Dahongjun» в данном исследовании [5].

Род Russula характеризуется несколькими легко узнаваемыми чертами: хрупкой консистенцией мясистого базидиокарпа из-за присутствия сфероцист, отсутствием латекса в базидиокарпе и базидиоспорами с наростами амилоида [6] — [7]. Однако различение отдельных видов в пределах этого рода часто бывает очень трудным из-за большого количества близкородственных видов, обширной фенотипической пластичности среди штаммов внутри видов и отсутствия макроморфологических признаков для их разделения.Подобные проблемы существуют и для многих других групп грибов. Следовательно, растет использование молекулярной информации, чтобы помочь определить и идентифицировать новые виды или отдельные группы морфологически неотличимых видов. В настоящее время большинство исследований по внутриродовой классификации Russula и популяционной биологии выполнено с использованием европейских и североамериканских образцов [8] — [13]. Разнообразие и генетическая структура видов Russula в других частях мира остаются плохо изученными.

Из-за очень изменчивого климата и разнообразного рельефа южный (особенно юго-западный) Китай входит в число 34 горячих точек мира по биоразнообразию [14]. Например, около 600 из 2000 видов съедобных грибов во всем мире встречаются в провинции Юньнань на юго-западе Китая [15]. Некоторые из экономически важных грибов из этого региона включают Boletus edulis sensu lato, Thelephora ganbajun M. Zang, Tricholoma matsutake (S. Ito & S.Imai) Singer и Russula spp. [16] — [20]. Действительно, большие популяции Russula встречаются по всей провинции Юньнань. Многие виды Russula собираются и продаются на местных рынках или экспортируются для потребления человеком. Среди этих грибов Russula один, который коренные жители Юньнани называют «Дахонгжун» («Большой красный гриб»), вероятно, является самым известным. Этот гриб собирают и продают на местных, национальных и международных рынках более 20 лет.Как и многие другие дорогие дикие грибы для гурманов, такие как мацутаке, ганбаджун и лисички, Russula нельзя культивировать искусственно из-за их зависимости от живого растения-хозяина. Поэтому естественные популяции в лесах — единственный источник сбыта.

Как и для многих грибов на юге Китая, точная официальная статистика рынка Дахунцзюня недоступна. Однако наши личные контакты с охотниками за грибами и торговцами за последние несколько лет показали, что сбор этого гриба в июне и июле каждого года часто обеспечивает до половины годового дохода семьи для многих людей в южной и центральной частях Юньнани.В эти месяцы свежий Dahongjun может продаваться по цене 8 долларов США / кг, а сушеные продукты часто продаются по цене 50-80 долларов США / кг. Однако значительные прибыли, неконтролируемые методы лесозаготовок в последние годы, нарушение лесной экосистемы и потеря мест обитания могут угрожать диким популяциям Дахонджуна в регионах. Чтобы помочь сохранить его естественные популяции и разработать эффективные стратегии сохранения и использования, важно понимать популяции этого гриба в их естественном ареале распространения.

Исторически грибные энтузиасты и микологи считали Дахунцзюнь на юге Китая R. vinosa Lindblad, который был первоначально описан в Европе [6], [12], [21]. Надежность этого определения для китайского R. vinosa сомнительна, поскольку формального таксономического исследования этого вида не проводилось, а молекулярная информация о китайском Russula отсутствует в каких-либо общедоступных базах данных. Недавно было обнаружено, что популяция Dahongjun из южной части Юньнани имеет последовательности во внутренних транскрибируемых спейсерных областях (ITS), сильно отличающиеся от таковых у типичных R.vinosa из Европы [12], [22], и эта группа недавно была описана как новый вид R. griseocarnosa X. H. Wang et al. [20].

Целью настоящего исследования является изучение генетического разнообразия и взаимоотношений между штаммами и популяциями Dahongjun из их основных регионов распространения на юге Китая, а также изучение их филогенетических взаимоотношений с другими близкородственными и известными видами Russula . Последовательности ДНК в ITS-регионе были получены для всех 122 образцов грибов из пяти местных популяций в трех географических регионах.Поскольку ITS повторяется в кластере ядерных рибосомных генов, полиморфизмы, наблюдаемые для ITS, могут быть связаны с вариациями среди повторов на одной и той же хромосоме и / или вариациями между последовательностями на двух разных хромосомах типичного дикариотического гриба. Чтобы свести к минимуму осложнения, связанные с интерпретацией полиморфизмов ITS-последовательностей, подмножество из 43 изолятов было дополнительно проанализировано с использованием частей трех других генов: большой ядерной субъединицы гена рибосомной РНК (nucLSU рРНК), митохондриальной малой субъединицы рибосомальной РНК. ген (mtSSU рРНК) и вторая по величине субъединица фермента ядерной РНК-полимеразы II (RPB2).Следует отметить, что ген рРНК nucLSU расположен в том же кластере генов, что и ITS, и в результате они не являются полностью независимыми. Кроме того, как гены рРНК nucLSU, так и гены рРНК mtSSU являются высококонсервативными, обычно демонстрируя ограниченные вариации или отсутствие вариаций среди штаммов в пределах одного и того же вида. Несмотря на эти недостатки, эти три фрагмента гена были выбраны здесь, потому что было обнаружено, что они способны различать родственные виды грибов, и что в общедоступных базах данных есть хорошо зарекомендовавшие себя праймеры для амплификации этих генов для этой группы организмов [6], [20] — [22].Паттерны вариации последовательностей внутри и между штаммами и популяциями были проанализированы для этих четырех генов с использованием филогенетических и популяционно-генетических методов. Наши результаты показывают, что проанализированные здесь образцы Дахонгджун из южного Китая включают по крайней мере три расходящиеся линии, каждая из которых содержит образцы из двух-трех географических регионов.

Результаты

Вариация последовательности ITS

Всего было собрано 122 экземпляра Дахунцзюнь из пяти географических точек, распределенных в трех регионах: центральном Юньнани, южном Юньнани и восточной части Гуанси (Рисунок 1; Таблица 1).Все образцы были успешно амплифицированы с использованием пары праймеров ITS1 и ITS4, и полученные продукты ПЦР секвенировали в обоих направлениях (номера доступа в GenBank FJ613896-FJ614017). Эти последовательности были выровнены с использованием Clustal_X версии 2 [23] и проанализированы с помощью PAUP [24]. Среди 683 выровненных нуклеотидных сайтов 82 были вариабельными, 54 показывали замены отдельных оснований и 28 показывали вставку / делецию (инделки) (таблица S1). 28 независимых сайтов находились на 13 дорожках, три из которых содержали три или более последовательных нуклеотида.Все инделки были обнаружены между штаммами, и ни одна из них не была обнаружена ни в одном из 122 штаммов (Таблица S1). В результате все наши хроматограммы последовательности ITS были однозначными в обоих направлениях.

Рис. 1. Пункты сбора проб Дахунцзюнь на юге Китая.

Провинции Юньнань и Гуанси выделены красным цветом. Дадуган (DDG), Цзиньо (JN) и Менгла (ML) в южной части Юньнани отмечены черными треугольниками; Айлаошань (AL) в центральной части Юньнани отмечен синим треугольником, а Цанву (CW) в восточном регионе Гуанси отмечен желтым треугольником.

https://doi.org/10.1371/journal.pone.0010684.g001

Наш анализ этих последовательностей показал, что наши образцы содержали по крайней мере три филогенетически различных клона (рисунок 2; таблица 1). Первая линия (линия 1) содержала 85 штаммов из региона Аилаошань (AL) в центральной части Юньнани и 5 штаммов из Кангу (CW) в восточной части Гуанси (GX). Эта линия содержала в общей сложности 42 ITS генотипа, из которых 37 — от AL и 5 — от CW. Наиболее распространенный генотип ITS в популяции AL был общим для 16 образцов, а 25 генотипов из AL были представлены одним изолятом каждый.Вторая группа (Lineage 2) содержала 27 изолятов, в том числе 9 из Mengla (ML), 8 из Jinuo (JN), 8 из Dadugang (DDG) и 2 из CW. Среди 27 штаммов Lineage 2 было идентифицировано 17 генотипов ITS. Наиболее распространенный генотип в Lineage 2 разделяли 3 изолята, и по 10 генотипов каждый был обнаружен только в одном изоляте. Третья группа (Lineage 3) включала 3 штамма из DDG и 2 штамма из CW. Каждый из трех образцов из DDG имел разные генотипы ITS, в то время как два образца из CW имели общий генотип ITS.Уникальная информация о генотипе ITS и распределение генотипов ITS внутри и среди 5 местных популяций представлены в Таблице 1 и Таблице S1.

Рис. 2. Дерево максимальной экономии, основанное на последовательностях ITS из 122 изолятов Dahongjun из южного Китая.

Каждая этикетка штамма содержит информацию о его географическом местонахождении (AL: Айлаошань, центральный Юньнань; CW: Канву, восточный Гуанси; DDG: Дадуган, южный Юньнань; JN: Цзиньо, южный Юньнань; ML: Менгла, южный Юньнань), за которым следует номер изоляции поля.Числа вдоль ветвей представляют собой значения начальной загрузки, превышающие 90%, полученные из 1000 повторов. Контрольные последовательности содержат идентификацию видов (если таковая имеется) до тех, что указаны в базе данных, за которыми следует конкретный регистрационный номер GenBank. Последовательности образцов, не принадлежащих к Дахонгджуну, используются как чужие группы. Длина дерева = 368, индекс согласованности = 0,766, индекс удерживания = 0,943.

https://doi.org/10.1371/journal.pone.0010684.g002

Сравнение последовательностей показало два заметных отрезка различий последовательностей в области ITS2 среди трех клонов.В частности, первый участок включает вставку / делецию 3 bp-5 bp в области poly-T, причем вставки присутствуют среди штаммов только в Lineage 2. Второй участок последовательности представляет собой вставку / делецию 18 bp с присутствующей делецией. среди штаммов только Lineage 3. В целом, мы идентифицировали в общей сложности 63 ITS-типа последовательностей, и эти типы последовательностей различались от 1 до 90 нуклеотидных сайтов (из 683 выровненных нуклеотидов в таблицах S1 и S2). Количество общих сайтов сегрегации, фиксированных и общих полиморфных сайтов внутри и между отдельными клонами суммировано в таблице 2.

Сравнение наших последовательностей ITS и последовательностей, тесно связанных с GenBank

ITS-последовательностей, представляющих 63 ITS-генотипа, идентифицированных выше, были использованы в качестве запросов для идентификации аналогичных последовательностей в GenBank посредством поиска BLAST. Мы получили все последовательности, длина которых сравнима с нашей, и которые показали общую идентичность последовательностей ≥90% с нашими последовательностями Дахонгджун. Чтобы сравнить относительную дивергенцию наших последовательностей между собой, а также с таковыми внутри других близкородственных видов и между ними, мы также по возможности включили несколько ITS-последовательностей из нескольких других видов Russula .Всего из GenBank было извлечено 17 эталонных последовательностей для сравнения с нашими последовательностями. Они включали три ITS-последовательности R. griseocarnosa , недавно идентифицированные на основе трех образцов Dahongjun в южной части Юньнани [20], и 12 ITS-последовательностей из GenBank, представляющих 5 близкородственных видов в Russula ( R. vinosa , R. Claroflava , R. occidentalis , R. decolorans , R. xerampelina ; дополнительный рисунок S1).Кроме того, одна последовательность GenBank, полученная непосредственно из образца ДНК окружающей среды (FJ803977), и один гриб, не идентифицированный на уровне вида, но отмеченный как принадлежащий к Russula sp. (DQ777988) также соответствовал нашим критериям (т.е.сравнимой длины последовательности и ≥90% идентичности последовательностей с нашими последовательностями), и оба были включены в наш анализ. Последовательность из окружающей среды (FJ803977) отличалась по двум и четырем нуклеотидным сайтам от двух известных последовательностей R. vinosa , AY061724 и AF418638, соответственно.Мы полагаем, что FJ803977, скорее всего, принадлежал к R. vinosa .

Совместный анализ наших последовательностей и последовательностей из GenBank подтвердил отличительные особенности трех линий в пределах Дахунцзюня из южного Китая. Одна линия (Lineage 2) соответствовала известному виду R. griseocarnosa , недавно идентифицированному из южной части Юньнани [20]. Разделение этих трех линий было подтверждено значениями бутстрапа 98%, 100% и 100%. Точно так же отделение Dahongjun от близкого вида R.vinosa имел 100% поддержку бутстрепа, включая большие филогенетические дистанции между ними (рис. 2). В целом, расхождения между тремя выделенными здесь линиями были сопоставимы или больше, чем расхождения среди близкородственных известных видов Russula (рис. 2).

Филогеографический образец вариации последовательности ITS

Интересно, что, как показано на Рисунке 2 и упоминалось выше, каждая из трех линий содержала штаммы из провинций Юньнань и Гуанси.Однако в пределах двух из трех линий, образцы из этих двух провинций, по-видимому, сгруппировались отдельно (Таблица 1 и Рисунок 2). В частности, в Lineage 1 образцы из AL и CW были разделены на две отдельные подгруппы. Точно так же в Lineage 3 образцы из DDG и CW были разделены на две группы. Другая картина наблюдалась в Lineage 2. Здесь шестнадцать генотипов из ML, JN, DDG, CW и один генотип R. griseocarnosa (также из DDG) были сгруппированы в подгруппу 1.Подгруппа 2 в Lineage 2 включала четыре образца из южного Юньнани, один из ML, один из DDG и два изолята R. griseocarnosa из Xishuangbana в южной части Юньнани [20; Таблица 1; Фигура 2].

Анализ множественных последовательностей генов подтверждает существование трех дивергентных линий

Чтобы проверить, представляют ли клоны и потенциально подсети, идентифицированные выше на основе ITS-последовательностей, потенциально репродуктивно изолированные криптические виды, мы секвенировали три дополнительных фрагмента гена для выбранной подгруппы из 43 изолятов.Эти изоляты включали 35 штаммов в ITS Lineage 1 и по четыре штамма из Lineages 2 и 3 (Таблица 1 и Рисунки 2 и 3). По крайней мере, два штамма были включены из каждой из под-линий ITS, упомянутых выше. В общей сложности последовательность из 1753 дополнительных нуклеотидов была получена из каждого из 43 изолятов, включая 902 п.н. из рРНК nucLSU (номера доступа GenBank GU352938-GU352980), 429 п.н. из рРНК mtSSU (номера доступа GenBank GU352981-GU353023) и 422 п.н. из RPB2 (номера доступа в GenBank GU353024-GU353066). Эти последовательности были выровнены и проанализированы.Наша гипотеза заключалась в том, что если эти три линии и их подсети представляют собой репродуктивно изолированные криптические виды, мы должны увидеть последовательное расхождение между четырьмя фрагментами ДНК. Напротив, отсутствие последовательной дивергенции среди генов предполагает, что они принадлежали к одной и той же репродуктивной группе в природе [25], [26]. Ниже мы кратко описываем паттерны вариации последовательностей и дивергенции трех дополнительных локусов внутри и между линиями и под-линиями Dahongjun.

Рис. 3. Дерево максимальной экономии, основанное на конкатенированных последовательностях четырех фрагментов ДНК для 43 изолятов Dahongjun из южного Китая.

Для каждого изолята первые 2–3 буквы относятся к их географическому положению (метки местоположения такие же, как на рисунке 2), а числовые цифры относятся к номерам изоляции полей. Числа вдоль ветвей представляют собой значения начальной загрузки, превышающие 90%, полученные из 1000 повторов. Длина дерева = 155, индекс согласованности = 0,718, индекс удержания = 0.885.

https://doi.org/10.1371/journal.pone.0010684.g003

Для фрагмента ДНК nucLSU рРНК наш анализ 902 выровненных нуклеотидных сайтов выявил в общей сложности 13 вариабельных сайтов среди 43 штаммов. Эти вариабельные сайты разделили 43 штамма на 6 типов последовательностей, принадлежащих к трем филогенетически хорошо поддерживаемым группам (значения начальной загрузки 84–99%; Рисунок S1). В частности, эти группы соответствовали трем линиям, идентифицированным с использованием последовательностей ITS (Рисунок 2 и Рисунок S1).Внутри линии 1 не было обнаружено вариаций последовательности в пределах одной из суб-линий, но между двумя суб-линиями наблюдалась разница в одном нуклеотидном сайте. Одно нуклеотидное различие также разделяло две под-линии в Lineage 2. Однако было два нуклеотида, которые различались между двумя штаммами (DDG2-2 и JN24) в пределах под-линии 1. В отличие от линий в Lineages 1 и 2, нет нуклеотидные вариации были обнаружены в гене рРНК nucLSU среди четырех секвенированных штаммов в Lineage 3 (Рисунок S1).

Для фрагмента гена рРНК mtSSU анализ 429 нуклеотидов среди 43 изолятов выявил 2 вариабельных сайта и 3 генотипа. Три генотипа точно соответствовали трем линиям, идентифицированным на основе ITS-последовательностей. В отличие от трех других секвенированных фрагментов ДНК, не было вариаций последовательностей между штаммами в пределах любой из трех линий в локусе рРНК mtSSU (рисунок S2).

Для фрагмента гена RPB2 наш анализ 422 нуклеотидов выявил 22 вариабельных сайта и 26 генотипов среди 43 проанализированных штаммов.Те же три линии, выявленные последовательностями генов ITS, nucLSU рРНК и mtSSU рРНК, также были очевидны из последовательностей RPB2. У этого фрагмента гена были две дополнительные примечательные особенности. Во-первых, как и в случае с фрагментом гена рРНК mtSSU, не было доказательств дивергенции между парами суб-линий в пределах любой из трех линий (Рисунок S3). Во-вторых, в то время как полиморфизм последовательностей не был обнаружен ни в Lineage 2, ни в 3, 13 нуклеотидных сайтов были обнаружены вариабельными среди 35 штаммов в Lineage 1.Эти вариабельные сайты разделили 35 штаммов в Lineage 1 на 24 типа последовательности RPB2. Два наиболее часто встречающихся генотипа RPB2 здесь содержали по три штамма, 7 генотипов содержали по два штамма, а остальные 15 генотипов содержали по одному штамму каждый (Рисунок S3).

В совокупности наши генеалогические анализы четырех фрагментов ДНК позволяют предположить, что проанализированные здесь образцы представляли три репродуктивно изолированных филогенетических вида. В соответствии с наблюдаемым филогенетическим паттерном, описанным выше, тест на однородность разделения также не смог отвергнуть гипотезу о том, что четыре генеалогии генов были статистически совпадающими (p = 0.99). Кроме того, для каждого из четырех наборов данных мы использовали тест на перестановку, зависящую от топологии, реализованный в PAUP, и ограничили топологии дерева, чтобы они соответствовали трем линиям передачи. Мы обнаружили, что ни одно из ограниченных MP-деревьев не было длиннее, чем соответствующие MP-деревья без каких-либо ограничений, и что топологическое ограничение для каждого из фрагментов гена существенно не отличалось от топологий других трех фрагментов гена с такими же ограничениями. Эти результаты согласуются с реципрокной монофилией трех линий среди четырех секвенированных фрагментов генов.Объединенная филогения, основанная на конкатенированных последовательностях всех четырех фрагментов ДНК (2434 п.н.), представлена ​​на рисунке 3.

Выводы гаплотипов и доказательства рекомбинации

В этом исследовании, хотя основная цель заключалась в изучении филогенетического разнообразия Dahongjun из южного Китая, доступность данных по мультилокусным последовательностям для 33 штаммов популяции Ailaoshan (линия 1 на рисунке 2) в центральной части Юньнани дала нам возможность изучить сыграла ли рекомбинация роль в создании наблюдаемого генетического разнообразия в этой популяции.Типичные тесты для доказательства рекомбинации внутри микробных популяций исследуют ассоциации между аллелями одного и того же локуса (для диплоидных, дикариотических или гетерокариотических организмов) или между локусами (для гаплоидных организмов с более высокой плоидностью). Статистически значимые ассоциации между аллелями будут соответствовать клональному воспроизводству, тогда как случайные ассоциации между аллелями будут соответствовать половому воспроизводству [26].

Чтобы изучить взаимосвязь между аллелями внутри и между локусами в популяции Айлаошан, мы сначала вывели аллели для каждого из четырех фрагментов ДНК для 33 штаммов, используя компьютерную программу PHASE 2.1 [27]. Из четырех секвенированных фрагментов ДНК два (nucLSU рРНК и mtSSU рРНК) были неизменными среди 33 штаммов Ailaoshan, и все эти штаммы были гомозиготными по всему секвенированному фрагменту. В результате эти два фрагмента гена не были включены в дальнейший анализ структуры популяции в популяции айлаошань. Остальные два фрагмента ДНК, ITS и RPB2, содержали 6 и 13 вариабельных сайтов соответственно, и они выявили 15 и 24 сложных типа последовательностей соответственно в этой популяции.

В рамках ITS четыре из 6 вариабельных нуклеотидных сайтов были гетерозиготными в пределах по крайней мере одного штамма, в то время как оставшиеся два были гомозиготными во всех штаммах, но различались между 33 штаммами. Из 33 штаммов восемь были гомозиготными по всем положениям нуклеотидов ITS, а остальные 25 штаммов имели от 1 до 3 гетерозиготных сайтов каждый. В локусе RPB2 7 из 13 вариабельных нуклеотидных сайтов были гетерозиготными в пределах по крайней мере одного штамма. Десять из 33 штаммов были гомозиготными по всем положениям нуклеотидов RPB2, в то время как остальные 23 штамма имели от 1 до 4 гетерозиготных сайтов каждый.Когда информация о генотипе как из локусов ITS, так и из локусов RPB2 была объединена, три из 33 штаммов были гомозиготными по обоим локусам, 15 штаммов были гетерозиготными по локусам ITS или RPB2, а 15 штаммов были гетерозиготными по обоим локусам. Всего для 33 изолятов был идентифицирован 31 би-локусный (ITS и RPB2) генотип: два были представлены двумя образцами каждый, а остальные 29 генотипов были представлены одним образцом каждый.

Анализ PHASE выявил 11 гаплотипов ITS и 29 гаплотипов RPB2 в пределах 33 штаммов.Отношения между предполагаемыми гаплотипами для фрагментов ДНК ITS и RPB2 для 33 штаммов Ailaoshan показаны на дополнительных рисунках S4 и S5 соответственно. Затем информацию о гаплотипе (или аллеле) и генотипе анализировали на предмет их ассоциации друг с другом с помощью программы Multilocus [28]. Результаты нашего анализа согласуются с рекомбинацией в этой естественной популяции Дахонгджун. В частности, наблюдаемое значение I A составляло 0,02437, что незначительно отличается от диапазона распределения I A , полученного из 1000 рандомизированного набора данных (-0.08969 до 0,06463; р = 0,23). Кроме того, эти два локуса были филогенетически несовместимы в этой популяции, о чем свидетельствует наличие всех возможных комбинаций генотипов между парами гаплотипов в этих двух локусах. В частности, две пары штаммов показали явные доказательства филогенетической несовместимости: AL9-2-1 и AL9-5; и AL18-4 (или AL18-5) и AL7-1 (рисунки S4 и S5).

Обсуждение

В этом исследовании мы использовали последовательности ДНК для анализа разнообразия и структуры населения в пределах и среди географических образцов Дахунцзюня на юге Китая.Наш филогенетический анализ генотипов ITS выявил три различных клона среди коммерчески собранных образцов дикого дахонджуна (рис. 2). Наблюдаемые расхождения последовательностей между тремя линиями в локусе ITS были сопоставимы или превышали расхождения между несколькими из близкородственных известных видов Russula (рис. 2). Отличительные особенности этих трех линий были дополнительно подтверждены нашим анализом последовательностей ДНК трех других генов. Значительное и последовательное расхождение между этими линиями предполагает, что Дахунцзюнь на юге Китая представляет собой комплекс видов и что каждая линия представляет собой отдельный филогенетический вид.Ниже мы обсудим актуальность наших результатов для таксономии, популяционной генетики и биологии сохранения этого гриба в природе.

Филогенетика и систематика

Множественный генеалогический анализ генов стал обычным методом решения проблем распознавания видов и выявления закономерностей генетической изменчивости в естественных микробных популяциях, в том числе грибов [25], [26]. Действительно, концепция филогенетических видов, основанная на генеалогической конгруэнтности генов, в настоящее время является одним из наиболее распространенных методов идентификации видов грибов, и многие грибы, которые ранее считались принадлежащими к одному виду, на самом деле содержат несколько филогенетически различных криптических видов [например.грамм. 29] — [35]. Например, грибковые патогены человека Cryptococcus neoformans [29], [30], Candida spp. [31] и Histoplasma capsulatum [32], эндемичный гриб для гурманов из юго-западного Китая Thelephora ganbajun [18], микоризные грибы Paxillus inculutus [33] и Cenococcum geophilum decay Boletales Serpula himantioides [35] были идентифицированы как комплексы видов, каждый из которых содержит два или более криптических вида.

Наш анализ показал, что ни один из наших образцов не имел ITS-последовательностей, идентичных Russula vinosa , виду, ранее считавшемуся населенным Дахонгджун из южного Китая (рис. 2). Отличие Dahongjun от других известных видов Russula имело 100% поддержку бутстрапа с большими филогенетическими дистанциями между ними. Таким образом, эти результаты показывают, что ни одна из трех линий Dahongjun не принадлежала к R. vinosa или, вероятно, к каким-либо другим видам Russula , описанным в Европе и Северной Америке, включая последовательности, подобные Russula , непосредственно полученные в образцах ДНК окружающей среды.Кроме того, недавно предложенный R. griseocarnosa представлял только одну из трех линий передачи Дахонгджун (Линия 2 на Рисунке 2). Подробная морфологическая, экологическая и дальнейшая молекулярная характеристика линий 1 и 3 находится в стадии разработки.

В то время как последовательности ITS предполагали, что все три линии содержат дополнительные суб-линии, поддержка со стороны трех других фрагментов ДНК для филогенетической отличимости суб-линий была слабой или отсутствовала. Наш результат согласуется с недавним таксономическим описанием R.griseocarnosa , который включает три последовательности, охватывающие обе подгруппы в Lineage 2 [20]. Однако два из трех проанализированных здесь фрагментов ДНК, не относящихся к ITS (гены рРНК nucLSU и рРНК mtSSU), очень консервативны и обычно не информативны для разделения близкородственных видов или недавно разошедшихся популяций. Таким образом, мы хотели бы отметить, что текущие результаты не исключают возможность того, что некоторые из суб-линий могут быть потенциально репродуктивно изолированы друг от друга.Анализ дополнительных последовательностей ДНК из других генов в геномах Dahongjun, а также включение большего количества образцов должны помочь решить проблему дополнительных репродуктивно изолированных подгрупп внутри каждой из трех линий.

Вариация разнообразия последовательностей среди фрагментов генов

Среди четырех фрагментов ДНК, проанализированных здесь для популяции Айлаошан в Дахонгджуне, два гена рибосомной рРНК (nucLSU рРНК и mtSSU рРНК) были гораздо менее вариабельными, чем фрагменты ДНК ITS и RPB2.Ограниченное разнообразие последовательностей рРНК nucLSU и mtSSU, вероятно, связано с их функциональными ограничениями на уровне нуклеотидной последовательности. Ограниченные вариации между штаммами внутри вида также наблюдались у многих других грибов в этих двух локусах [например, 29], [31], [36]. Между ITS и RPB2 ITS был более вариабельным и выявил больше генотипов, чем RPB2 в Lineages 2 и 3. Это могло быть связано с многокопийной природой последовательностей ITS, потому что паралоги, содержащие замены, будут вносить вклад в количество наблюдаемых здесь типов последовательностей.Однако последовательности RPB2 выявили немного больше генотипов, чем ITS (24 против 21) среди 35 штаммов в Lineage 1.

Географические закономерности изменения последовательности

Наш филогеографический анализ показывает, что каждая из трех указанных здесь линий имеет относительно широкое географическое распространение. В частности, все три линии передачи содержали образцы из провинций Юньнань и Гуанси. Однако в пределах каждой из трех линий (то есть филогенетических видов) география, вероятно, сыграла некоторую роль в наблюдаемой изменчивости последовательностей.Например, образцы Юньнани и Гуанси были раздельно сгруппированы в Линии 1 и 3 в филогении ITS. В провинции Юньнань Линия 1 была обнаружена только в Айлаошане в центре Юньнани, в то время как Линии 2 и 3 были обнаружены только на юге. Эти результаты согласуются как с древним видообразованием между тремя линиями, так и с продолжающимся расхождением среди географических популяций внутри отдельных линий. Подобные типы географических паттернов вариации последовательностей ДНК наблюдались и во многих других группах грибов.Например, отдельные аллели наблюдались в географически разделенных популяциях Russula brevipes [8]. Кроме того, в другом грибе для гурманов тыс. ganbajun из центрального и южного Юньнани, было идентифицировано несколько потенциально загадочных видов, а распространение большинства загадочных видов было географически ограничено, при этом большинство типов последовательностей ITS были обнаружены уникальными для одной или нескольких близких местных популяций [18]. Эти результаты согласуются с аллопатрическим видообразованием.

Хотя наши результаты показали, что географическое разделение в значительной степени способствовало наблюдаемой вариации последовательностей между и внутри отдельных клонов, данные также указали на доказательства рассредоточения и потока генов между некоторыми местными и региональными популяциями Дахонджуна. Например, все три линии содержат штаммы как из Юньнани, так и из Гуанси, что соответствует древнему и / или недавнему расселению и потоку генов. Кроме того, было обнаружено несколько идентичных нуклеотидных последовательностей, общих у штаммов из этих двух провинций в трех из четырех проанализированных локусов (рисунки S1, S2 и S3).Хотя отобранные участки были разделены друг от друга на расстояние до 1500 км, предполагаемый выше поток генов не обязательно должен быть рассредоточением на большие расстояния, а вместо этого может быть вызван рассредоточением на короткие расстояния через еще не идентифицированные географические популяции этой группы организмов. Недавний популяционно-генетический анализ показал, что распространение спор на короткие расстояния является обычным явлением, в то время как распространение на большие расстояния относительно редко среди эктомикоризных грибов (включая виды из рода Russula ) [37] — [42].Например, эмпирические наблюдения показали, что базидиоспоры могут перемещаться на расстояние до 500 м с помощью воздушных потоков в Tricholoma matsutake [41]. Аналогичным образом, распространение спор белками на расстояние до 2090 м было зарегистрировано у нескольких гипогенных и эпигейных грибов [42]. Распространению грибов на короткие и большие расстояния могут способствовать ветер, животные, люди и деятельность человека [36]. Действительно, для нескольких видов грибов из Юньнани, в том числе для изысканных грибов T.matsutake и T. ganbajun [17] — [19], [43].

Репродуктивная изоляция, способ воспроизводства и последствия управления ресурсами

Важно отметить, что в двух географических точках, DDG в южной части Юньнани и CW в восточной части Гуанси, были обнаружены штаммы, принадлежащие к двум и трем линиям Dahongjun соответственно. Существование штаммов из разных линий в одном и том же географическом местоположении, но без смешения аллелей, согласуется с тем, что они репродуктивно изолированы друг от друга [34].В настоящее время механизм (ы) потенциальной репродуктивной изоляции среди этих клонов остается неизвестным. Действительно, информации о том, как эти грибы размножаются в природе, относительно мало. Учитывая наблюдаемую гетерозиготность внутри штаммов по локусам ITS и RPB2 и случайные ассоциации между их аллелями в популяции Айлаошань, мы предполагаем, что популяция Айлаошан, вероятно, имеет гетероталлический жизненный цикл и что половое спаривание и рекомбинация являются важными компонентами ее воспроизводства.Среди грибов-базидиомицетов половое спаривание и рекомбинация может осуществляться между генетически совместимыми особями либо посредством инбридинга (между близкородственными), либо ауткроссинга (между генетически отдаленно родственными) [26]. Такая рекомбинация может включать либо самостерильный гаплоидный мицелий, прорастающий из базидиоспор, либо фертильный диплоидный (или дикариотический) мицелий [например, 44].

Наши данные о сексуальной рекомбинации в популяции айлаошань в Дахонгджуне могут иметь серьезные последствия для управления и сохранения этого ресурса.В настоящее время из-за конкуренции среди грибников растет доля грибов Дахонгджун, собираемых на незрелой стадии, до открытия шляпки грибов и высвобождения из них базидиоспор. В результате грибы, которые могли способствовать будущему воспроизводству этих популяций в природе, все больше исключались из генофонда грибными охотниками. Если эта тенденция сохранится, генетическое разнообразие многих из этих популяций может быстро уменьшиться, что приведет к потенциальному исчезновению популяций.Действительно, многие местные географические популяции изысканного гриба T. matsutake вокруг Куньмина, столицы провинции Юньнань, исчезли за последние 20 лет, вероятно, из-за потери среды обитания, неконтролируемого чрезмерного сбора незрелых плодовых тел и / или к физическим повреждениям подземной микоризы при поиске грибов [19], [43].

В заключение, наше исследование предполагает, что коммерчески собранный Dahongjun представляет собой комплекс видов, состоящий как минимум из трех различных линий.Более обширный отбор образцов и анализ с использованием других последовательностей генов могут выявить дополнительные отдельные клоны, а также новые модели распределения в пределах этого комплекса видов на юге Китая. Географические закономерности распространения указывают на то, что репродуктивная изоляция, вероятно, имела место среди этих трех линий. По крайней мере, в одной популяции Dahongjun в центральном Юньнани, популяции Ailaoshan, мы наблюдали признаки рекомбинации, вероятно, с участием базидиоспор. Хотя наши данные свидетельствуют о древнем и / или недавнем расселении и потоке генов среди этих географических популяций, такие события относительно ограничены.Наши результаты показывают, что следует позаботиться о сохранении генетического разнообразия в пределах этих местных популяций, чтобы обеспечить выживание и продолжение коммерческого сбора этого экологически и экономически важного гриба.

Материалы и методы

Выборка

Образцы плодовых тел Dahongjun были собраны из тропических и субтропических вечнозеленых лесов, в которых преобладают Castanopsis spp. и Lithocarpus spp. в провинциях Юньнань и Гуанси летом 2006 и 2007 годов.Из-за их коммерческой ценности и непригодности для выращивания среди местных жителей в каждом районе существовала значительная конкуренция за дикие грибы. Большинство местных грибников охраняют свои секретные места плодоношения грибов в лесах и не желают делиться информацией с другими. Кроме того, наиболее желанными плодовыми телами Дахонгджун являются незрелые (те, у которых закрыты колпачки), собранные, когда они все еще закопаны под землей и не видны невооруженным глазом. В результате тем, кто не знаком с местностью и местами плодоношения, было чрезвычайно сложно найти плодовые тела.Анализируемые здесь грибы были собраны с помощью одного сборщика в каждом месте, которому различными способами была гарантирована конфиденциальность мест их плодоношения. Были включены все плодовые тела, собранные во время двухдневных набегов в каждом месте. Эти образцы были идентифицированы на основании их морфологических особенностей, определенных местными грибниками и торговцами. Всего было собрано 122 плодовых тела из 4 районов провинции Юньнань и одного района провинции Гуанси.Эти регионы были выбраны для данного исследования из-за торговой активности в Дахонджуне, отмеченной торговцами грибами, с которыми мы столкнулись. Территории разделены примерно 1500 км с востока на запад и примерно 500 км с севера на юг. Географические местоположения выбранных участков показаны на рисунке 1. Географические координаты и размер выборки для каждого участка представлены в таблице 1.

Извлечение ДНК и секвенирование

Геномную ДНК экстрагировали из высушенных плодовых тел методом CTAB miniprep [45].Экстрагированную ДНК суспендировали в 50 мкл ТЕ-буфера, а затем разбавляли 1∶20 для использования в реакциях ПЦР. ITS-последовательность была получена для каждого из 122 грибов. Праймеры ITS1 (5′-TCCGTAGGTGAACCTGCGG-3 ‘) и ITS4 (5′-TCCTCCGCTTATTGATAGC-3’) использовали для амплификации ITS-областей кластера генов рибосомной РНК, которые включали ITS1, 5.8S и ITS2 [24]. Каждая реакция ПЦР содержала 10 мкл реакционного объема: 5 мкл GoTaq ® Green Master Mix 2 × (Promega), 1,5 мкл разведенной геномной ДНК, 1 мкМ каждого праймера и 1 мкл.5 мкл ддх3О. ПЦР проводилась по следующей программе: 4 мин при 94 ° C, затем 35 циклов по 30 с при 94 ° C, 30 с при 50 ° C и 90 с при 72 ° C, и последняя стадия удлинения при 72 ° C. ° C в течение 10 мин. Затем продукты ПЦР очищали и секвенировали с использованием циклического секвенирования с помощью BigDye®Terminator v3.1 (Applied Biosystems) в соответствии с протоколом производителя. Секвенирование было выполнено как в прямом, так и в обратном направлении для каждого образца с использованием праймеров ITS1 и ITS4. Секвенирование ДНК проводили в лаборатории MoBix на факультете биологии Университета Макмастера с использованием автоматического секвенатора ДНК ABI3100.

Части трех других генов были проанализированы на подмножество из 43 изолятов: большая ядерная субъединица гена рибосомной РНК (nucLSU рРНК), митохондриальная малая субъединица гена рибосомной РНК (mtSSU рРНК) и вторая по величине субъединица. фермента ядерной РНК-полимеразы II (RPB2). Праймеры для амплификации каждого из этих трех фрагментов гена следующие: LR0R (5 ‘ACCCGCTGAACTTAAGC 3’) и LR5 (5 ‘TCCTGAGGGAAACTTCG 3’) для гена рРНК nucLSU; MS1 (5 ‘AGCAGTGAGGAATATTGGTC 3’) и MS2 (5 ‘CTGACGTTGAAGGACGAAGG 3’) для гена рРНК mtSSU; и bRPB2-6F (5 ‘TGGGGYATGGTNTGYCCYGC 3’) и bRPB2-7R (5 ‘GAYTGRTTRTGRTCRGGGAAVGG 3’) для гена RPB2.Последовательности праймеров были получены с веб-сайта Assembly of the Fungal Tree of Life (AFTOL) (http://aftol.org/primers.php).

Выравнивание последовательностей и идентификация генотипа

Данные последовательности

ДНК, полученные в прямом и обратном направлениях, были собраны для каждого штамма с использованием программного обеспечения для анализа последовательностей SeqMan (DNASTAR, Inc.). Все гетерозиготные сайты кодировали с использованием следующих универсальных кодов неоднозначности: T / C = Y, A / G = R, A / C = M, G / T = K. Затем последовательности выравнивали с использованием Clustal_X версии 2 [23], и выравнивание было скорректировано вручную по мере необходимости.Выровненные последовательности затем вводили в PAUP * 4.0b10 [24] для идентификации уникальных типов последовательностей для каждого из четырех секвенированных фрагментов ДНК. Все выровненные нуклеотидные сайты, включая вставки / делеции, использовали для идентификации полиморфизмов последовательностей в каждом из четырех локусов.

Филогенетические анализы

Чтобы сравнить наши образцы с образцами в базах данных, наши ITS-генотипы использовались в качестве запросов для извлечения близкородственных последовательностей (≥90% идентичностей последовательностей) с сопоставимой длиной из GenBank.По возможности, несколько репрезентативных ITS-последовательностей из GenBank для каждого из близкородственных видов Russula также были включены для сравнения потенциальных внутривидовых вариаций филогенетических групп Dahongjun с таковыми внутри известных видов Russula . ITS-последовательности Russula griseocarnosa , который недавно был описан как новый вид, представляющий Дахунцзюнь из южной части Юньнани [20], также были включены в наш филогенетический анализ в качестве контрольных последовательностей.Наши собственные последовательности и все полученные из GenBank последовательности были затем выровнены с использованием Clustal_X версии 2 [24]. Выровненные последовательности были визуально проверены, скорректированы и импортированы в PAUP * 4.0b10 [24]. Были проведены анализы максимальной экономии и максимального правдоподобия. Топологическая поддержка оценивалась с помощью бутстраповской повторной выборки 1000 рандомизированных наборов данных.

Чтобы проверить, представляют ли расходящиеся клоны, выявленные последовательностями ITS, потенциально репродуктивно изолированные криптические виды, мы проверили соответствие между генеалогиями из разных локусов, используя тест на однородность разделения и тест на зависимую от топологии перестановку.Постоянное расхождение между группами изолятов по разным генам указывало бы на существование криптических видов, причем каждая клада представляет собой филогенетический вид [25], [46]. Эти анализы проводились с использованием программного обеспечения PAUP [24].

Вывод гаплотипа и тест на способ воспроизведения

Плодовые тела грибов, таких как Дахонджун, могут выделять большое количество мейотических спор. Если эти половые споры способствовали воспроизводству популяций в природе, мы должны иметь возможность обнаруживать сигнатуры случайных ассоциаций между аллелями в одном или разных локусах.Чтобы идентифицировать такие сигнатуры, мы сначала получили аллельную информацию по каждому из четырех локусов для 43 штаммов. Среди четырех секвенированных фрагментов ДНК два (рРНК nucLSU и рРНК mtSSU) были полностью гомозиготными в пределах каждого штамма (см. Результаты выше), в то время как ITS и RPB2 содержали гетерозиготные сайты. Предполагаемая информация о гаплотипах для ITS и RPB2 была получена с помощью программы PHASE 2.1 [27]. Вкратце, все вариабельные нуклеотидные сайты для ITS и RPB2 были отобраны и скомпилированы в требуемый формат для ввода в PHASE, а возможные гаплотипы и их частота в образцах были оценены с использованием байесовского анализа.Наши образцы были обработаны как дикарионы (диплоидные генотипы), проанализированные с использованием варианта двуаллельных (SNP) локусов. Если последовательность ДНК содержит гетерозиготные сайты, полученные гаплотипы будут иметь только одно основание на каждом сайте. Для последовательностей без гетерозиготных положений считалось, что они содержат единственный гомозиготный гаплотип. Каждому уникальному гаплотипу из этого выхода было присвоено определенное обозначение аллеля.

Чтобы изучить ассоциацию между аллелями и проверить способ воспроизводства, мы выбрали популяцию Айлаошань из-за доступности информации о генотипе от относительно большого количества штаммов.Здесь были проведены два общих теста для оценки аллельных ассоциаций: индекс ассоциации ( I A ) и тесты филогенетической несовместимости [26]. Тесты I A и филогенетической несовместимости были проведены с использованием программы Multilocus версии 1.0b [28]. Основные принципы и базовые статистические данные для этих двух тестов можно найти в руководстве по программе (28).

Как указывалось в предыдущих разделах этой рукописи, ITS-области многократно повторяются в кластере рибосомных генов на каждой хромосоме.Следовательно, гетерозиготные сайты могут не представлять нуклеотиды из двух разных хромосом, но вместо этого могут быть связаны с вариациями среди паралогов в одной хромосоме. Следовательно, следует соблюдать осторожность при анализе структуры популяции с использованием информации о гаплотипах из последовательностей ITS.

Дополнительная информация

Рисунок S1.

Дерево максимальной экономии, основанное на последовательностях большой ядерной рибосомной РНК (nucLSU рРНК) из 43 репрезентативных изолятов Russula spp.собраны в 5 исследовательских центрах в 3 регионах на юге Китая. Каждый штамм представлен своей географической принадлежностью (AL: Айлаошань, центральный Юньнань; DDG: Дадуган, южный Юньнань; JN: Цзиньо, южный Юньнань; ML: Менгла, южный Юньнань; и CW: Цангу, восточный Гуанси) и одним или несколькими числами. представляющий идентификацию нашей коллекции. Значения поддержки Bootstrap (1000 реплик) приведены выше веток. Длина дерева = 15, индекс согласованности = 1, индекс удержания = 1.

https://doi.org/10.1371 / journal.pone.0010684.s003

(0,16 МБ TIF)

Рисунок S2.

Дерево максимальной экономии, основанное на последовательностях рибосомной РНК малой субъединицы митохондрии (mtSSU рРНК) из 43 репрезентативных изолятов Russula spp. собраны в 5 исследовательских центрах в 3 регионах на юге Китая. Этикетки для штаммов идентичны таковым на рисунке S1. Значения поддержки Bootstrap (1000 реплик) приведены выше веток. Длина дерева = 2, индекс согласованности = 1, индекс удержания = 1.

https://doi.org/10.1371/journal.pone.0010684.s004

(0,16 МБ TIF)

Рисунок S3.

Дерево максимальной экономии на основе большой субъединицы ядерной РНК-полимеразы II (RPB2) из ​​43 репрезентативных изолятов Russula spp. собраны в 5 исследовательских центрах в 3 регионах на юге Китая. Этикетки для штаммов идентичны таковым на рисунке S1. Значения поддержки Bootstrap (1000 реплик) приведены выше веток. Длина дерева = 49, индекс согласованности = 0,673, индекс удержания = 0.853.

https://doi.org/10.1371/journal.pone.0010684.s005

(0,17 МБ TIF)

Рисунок S4.

Дерево максимальной экономии, основанное на предполагаемых последовательностях гаплотипов ITS 33 штаммов из Ailaoshan. Каждый гаплотип ITS представлен своей географической принадлежностью (AL: Ailaoshan, центральная часть Юньнани), одним или несколькими числами, представляющими идентификацию нашей полевой коллекции, за которыми следуют a или b, которые представляют два аллеля в пределах отдельного образца. Длина дерева = 10, индекс согласованности = 0.6, индекс удерживания = 0,955.

https://doi.org/10.1371/journal.pone.0010684.s006

(0,20 МБ TIF)

Рисунок S5.

Дерево максимальной экономии, основанное на предполагаемых последовательностях гаплотипов RPB2 33 штаммов из Ailaoshan. Каждый гаплотип RPB2 представлен своей географической принадлежностью (AL: Ailaoshan, центральная часть Юньнани), одним или несколькими числами, представляющими идентификацию нашей полевой коллекции, за которыми следуют a или b, которые представляют два аллеля в отдельном экземпляре.Длина дерева = 35, индекс согласованности = 0,486, индекс удерживания = 0,860.

https://doi.org/10.1371/journal.pone.0010684.s007

(0,21 МБ TIF)

Благодарности

Мы благодарим г-на Ли Чжи-Хун из Экологической станции Айлаошань Китайской академии наук за его помощь в организации сбора образцов Дахунцзюнь из Айлаошань в центре Юньнани. Мы также хотим поблагодарить наших грибников за их помощь в определении местоположения отдельных подземных плодовых тел грибов.В Университете Макмастера мы хотим поблагодарить доктора Хун Го за ее техническую помощь. Мы благодарим академического редактора доктора Саймона Джоли и четырех анонимных рецензентов за их предложения по улучшению статьи.

Вклад авторов

Задумал и спроектировал эксперименты: JL ZLY TJ JX. Проведены эксперименты: ML JL YL BF JX. Проанализированы данные: ML TJ JX. Предоставленные реагенты / материалы / инструменты анализа: JL JX. Написал статью: ML JL YL BF ZLY TJ JX.

Ссылки

  1. 1.Брундретт М. (2004) Разнообразие и классификация микоризных ассоциаций. Биологическое обозрение — Кембриджское философское общество 79: 473–495.
  2. 2.
    Кирк PM, Cannon PF, Minter DW, Stalpers JA (2008) Словарь грибов, 10-е издание. Oxon: CAB International.
  3. 3.
    Ли М., Сюй Дж. (2009) Молекулярная экология эктомикоризных грибов: молекулярные маркеры, генетика и экологическое значение. Acta Botannica Yunnanica 31: 193–209.
  4. 4.Хортон Т.Р., Брунс Т.Д. (2001) Молекулярная революция в эктомикоризной экологии: заглядывать в черный ящик. Молекулярная экология 10: 1855–1871.
  5. 5.
    Ян З.Л., Пипенбринг М. (2004) Дикие съедобные грибы в провинции Юньнань, юго-запад Китая. В: Агерер Р., Пипенбринг М., Бланц, редакторы. Границы в микологии базидиомикотов. IHW-Verlag. С. 419–426.
  6. 6.
    Romagnesi H (1967) Les Russules d’Europe et d’Afrique du Nord. Париджи: Бордас.
  7. 7.Певец Р. (1986) Agaricales в современной систематике. 4-е издание. Кенигштейн: Научные книги Кельца. С. 1–981.
  8. 8.
    Бергеманн С.Е., Миллер С.Л. (2002) Распределение размеров и устойчивость генов в местных популяциях эктомикоризных базидиомицетов поздней стадии, Russula brevipes . Новый фитолог 156: 313–230.
  9. 9.
    Бергеманн С.Е., Миллер С.Л., Гарбелотто М. (2005a) Микросателлитные локусы из Russula brevipes , распространенного эктомикоризного партнера нескольких видов деревьев в Северной Америке.Примечания к молекулярной экологии 5: 472–474.
  10. 10.
    Bergemann SE, Douhan GW, Garbelotto M, Miller SL (2005b) Нет данных о структуре популяции в трех изолированных субпопуляциях Russula brevipes в дубово-сосновых лесах. Новый фитолог 170: 177–184.
  11. 11.
    Buyck B, Mitchell D, Parrent J (2006) Russula parvovirescens sp. nov., распространенный, но игнорируемый вид на востоке США. Микология 98: 612–615.
  12. 12.Миллер С.Л., Байк Б. (2002) Молекулярная филогения рода Russula в Европе со сравнением современной внутриродовой классификации. Микологические исследования 106: 259–276.
  13. 13.
    Ричардсон MJ (1970) Исследования Russula emetica и других агариков на плантации сосны обыкновенной. Труды Британского микологического общества 55: 217–229.
  14. 14.
    Майерс Н., Миттермайер Р.А., Миттермайер К.Г. (2000) «Горячие точки» биоразнообразия для приоритетов сохранения.Nature 403: 853–858.
  15. 15.
    Ян З.Л. (2002) О ресурсах диких грибов и их использовании в провинции Юньнань, Юго-Западный Китай. Журнал природных ресурсов 17: 463–469.
  16. 16.
    Lian B, Zang JP, Hou WG, Yuan S, Smith DL (2008) Чувствительное обнаружение съедобного гриба Boletus edulis на основе ПЦР по ITS-последовательностям рДНК. Журнал биотехнологии 11: 1–8.
  17. 17.
    Sha T, Zhang H, Ding H, Li Z, Cheng L и др. (2007) Генетическое разнообразие Tricholoma matsutake в провинции Юньнань.Китайский научный бюллетень 52: 1212–1216.
  18. 18.
    Sha T, Xu J, Palanichamy MG, Zhang HB, Li T, et al. (2008) Генетическое разнообразие эндемичного гриба для гурманов Thelephora ganbajun из юго-западного Китая. Микробиология 154: 3460–3468.
  19. 19.
    Xu J, Sha T, Li YC, Zhao ZW, Yang ZL (2008) Рекомбинация и генетическая дифференциация среди природных популяций эктомикоризного гриба Tricholoma matsutake из юго-западного Китая.Молекулярная экология 17: 1238–1247.
  20. 20.
    Ван XH, Ян З.Л., Ли Ю.С., Кнудсен Х., Лю П.Г. (2009) Russula griseocarnosa sp. ноя (Russulaceae, Russulales), коммерчески важный съедобный гриб в тропическом Китае: микориза, филогенетическое положение и систематика. Новая Хедвигия 88: 269–282.
  21. 21.
    Legon NW, Henrici A, Roberts PJ, Walting R (2005) Контрольный список британских и ирландских базидиомикотов. Королевский ботанический сад, Кью 517:
  22. 22.Tedersoo L, Kõljalg U, Hallenberg N, Larsson KH (2003) Мелкомасштабное распределение эктомикоризных грибов и корней по слоям субстрата, включая грубые древесные остатки в смешанном лесу. Новый фитолог 159: 153–165.
  23. 23.
    Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) Интерфейс CLUSTAL_X – Windows: гибкие стратегии для множественного выравнивания последовательностей с помощью инструментов анализа качества. Исследование нуклеиновых кислот 24: 4876–4882.
  24. 24.Swofford DL (2002) PAUP *: Филогенетический анализ с использованием экономичности (и других методов), версия 4. Сандерленд, Массачусетс: Sinauer Associates.
  25. 25.
    Тейлор Дж. У., Якобсон Д. Д., Крокен С., Касуга Т., Гейзер Д. М. и др. (2000) Филогенетическое распознавание видов и видовые концепции грибов. Генетика и биология грибов 31: 21–32.
  26. 26.
    Xu J (2005) Основы генетического анализа молекулярных популяций грибов. В: Сюй Дж, редактор. С. 87–116. Horizon Scientific Press, Англия.
  27. 27.
    Стивенс М., Доннелли П. (2003) Сравнение байесовских методов для реконструкции гаплотипов. Американский журнал генетики человека 73: 1162–1169.
  28. 28.
    Агапов П.М., Берт А. (2001) Индексы неравновесия по мультилокусным сцеплениям. Примечания по молекулярной экологии 1: 101–102.
  29. 29.
    Xu J, Vilgalys R, Mitchell TD (2000) Множественные генеалогии генов показывают недавнее распространение и гибридизацию патогенного гриба человека Cryptococcus neoformans .Молекулярная экология 9: 1471–1481.
  30. 30.
    Bovers M, Hagen F, Kuramae EE, Boekhout T (2008) Шесть монофилетических линий, идентифицированных в пределах Cryptococcus neoformans и Cryptococcus gattii путем многолокусного типирования последовательностей. Генетика и биология грибов. 45: 400–421.
  31. 31.
    Pujol C, Dodgson A, Soll DR (2005) Популяционная генетика аскомицетов, патогенных для людей и животных. Великобритания: Horizon Scientific Press, Норвич. С. 149–188. В эволюционной генетике грибов под редакцией Дж.Сюй.
  32. 32.
    Kasuga T, White TJ, Koenig GL, McEwen JG, Restrepo A и др. (2003) Филогеография грибкового возбудителя Histoplasma capsulatum . Молекулярная экология 12: 3383–340.
  33. 33.
    Hedh J, Samson P, Erland S, Tunlid A (2008) Множественные генеалогии генов и распознавание видов в эктомикоризном грибе Paxillus invutus . Микологическое исследование 112: 965–975.
  34. 34.
    Douhan GW, Rizzo DM (2005) Филогенетическая дивергенция в местной популяции эктомикоризного гриба Cenococcum geophilum .Новый фитолог 166: 263–271.
  35. 35.
    Kauserud H, Stensrud Ø, DeCock C, Shalchian-Tabrizi K, Schumacher T. (2006) Множественные генеалогии генов и AFLP предполагают загадочное видообразование и распространение на большие расстояния в базидиомицете Serpula himantioides (Boletales). Молекулярная экология 15: 421–431.
  36. 36.
    Xu J, Cheng M, Tan Q, Pan Y (2005) Молекулярная популяционная генетика грибов базидиомицетов. В: Сюй Дж, редактор. С. 189–220. Horizon Scientific Press, Англия.
  37. 37.
    Lamb RJ (1979) Факторы, ответственные за распространение микоризных грибов Pinus в восточной Австралии. Австралийский журнал исследований леса 9: 25–34.
  38. 38.
    Аллен М., Фиппс Л.Е. (1984) Сравнительные микролиматы некоторых микоризных грибов: требования для распространения спрос на большие расстояния. Информационный бюллетень микологического общества Америки 35: 17.
  39. 39.
    Redecker D, Szaro TM, Bowman RJ, Bruns TD (2001) Малые гены Lactarius xanthogalactus , Russula cremoricolor и Amanita francheti в поздней стадии эктомикоризной сукцессии.Молекулярная экология 10: 1025–1034.
  40. 40.
    Лян И, Го Л.Д., Ма К.П. (2004) Генетическая структура популяции эктомикоризного гриба Russula vinosa в субтропических лесах на юго-западе Китая. Микориза 14: 35–240.
  41. 41.
    Lian CL, Narimatsu M, Nara K, Hogetsu T (2006) Tricholoma matsutake в естественном лесу Pinus densiflora : соответствие между наземными и подземными генами, ассоциация с несколькими деревьями-хозяевами и изменение существующих эктомикоризных сообществ.Новый фитолог 171: 825–836.
  42. 42.
    Бертолино С., Виццини А., Ваутерс Л.А., Този Г. (2004) Потребление гипогенных и эпигейных грибов красной белкой ( Sciurus vulgaris ) в субальпийских хвойных лесах. Экология и управление лесами 202: 227–233.
  43. 43.
    Сюй Дж, Го Х, Ян З.Л. (2007) Полиморфизмы одиночных нуклеотидов в эктомикоризном грибе Tricholoma matsutake . Микробиология 153: 2002–2012.
  44. 44.
    Xu J, Horgen PA, Anderson JB (1996) Соматическая рекомбинация в культивируемом грибе Agaricus bisporus .Микологические исследования 100: 188–192.
  45. 45.
    Xu J, Yoell HJ, Anderson JB (1994) Эффективный протокол выделения ДНК из высших грибов. Тенденции Genet 10: 226–227.
  46. 46.
    Фаррис JS, Källersjö M, Kluge AG, Bult C (1994) Проверка значимости несоответствия. Кладистика 10: 315–319.

Грибы Портобелло, фаршированные рисом — Три больших укуса

Один из самых больших рисков, связанных с грибами портобелло с рисом, заключается в том, что они получаются слишком темными и почти безвкусными.Грибы портобелло восхитительны и имеют приятную консистенцию и текстуру, но, честно говоря, они не обладают таким собственным вкусом, кроме землистого и грибного. Рис, конечно, тоже довольно мягкий. Так что, если вы не задумываетесь о том, как совместить их, ваше последнее блюдо не удастся.

Этот рецепт включает множество ярких ингредиентов, которые помогают создать более сложный набор вкусов. Вместо того, чтобы просто упасть, густая тьма грибов контрастирует с острой яркостью вяленых на солнце помидоров, белого вина и козьего сыра.Это напряжение между контрастными вкусами создает восхитительный гарнир или закуску, которую можно сочетать практически с чем угодно. Это тоже может быть основное блюдо — просто приготовьте два фаршированных портобелло на человека вместо одного!


Примечания к этому рецепту:

Лук-порей: После нарезки и мытья у вас должно получиться примерно 1 чашка плотно упакованных ломтиков лука-порея. Немного более или менее это нормально, но постарайтесь быть на этом уровне!

Белое вино: Я использую высококачественный (но не превосходный) совиньон-блан, яркий и фруктовый.Не стесняйтесь использовать любое белое вино по вашему выбору, но я рекомендую вино с более цитрусовым, а не травяным оттенком.

Козий сыр: Если у вас нет (или не нравится) козий сыр, вы можете заменить его любым другим ярким, острым сыром. Фета был бы самым очевидным выбором! Я бы порекомендовал использовать немного меньше феты, чем козий сыр, поскольку это может превзойти все блюдо.

Рис: Вам понадобится подготовленный вареный рис для этого блюда. Нет необходимости делать это свежим, если у вас уже есть остатки еды в холодильнике! Жидкость в рецепте поможет увлажнить остатки суточного риса.

Стебли и жабры грибов: В этом рецепте стебли и жабры грибов измельчаются и смешиваются с начинкой. На это есть две причины: уменьшить количество отходов и усилить грибной вкус. Однако он дает готовой рисовой смеси много маленьких черных пятен. Если вам это покажется неприглядным (я не считаю, но некоторым кажется!), Просто пропустите этап измельчения и добавления стеблей и жабр.

Время: Этот рецепт действительно быстр, если вы умеете работать одновременно с несколькими задачами! Я рекомендую сэкономить время, сделав такие вещи, как выдолбление грибов, пока лук-порей уже готовится, и рецепт написан соответствующим образом.

Порций: по этому рецепту готовятся четыре средних гриба портобелло с начинкой из риса. Каждый из них подходит для закуски или гарнира. Если вы хотите, чтобы это было основным блюдом, планируйте сервировку по два на человека вместо одного.


Предложения по обслуживанию:

Благодаря сочетанию яркого и землистого вкуса, эти грибы являются отличной закуской или гарниром практически к любому блюду. Я бы не стал подавать их с нежно приправленной рыбой, так как грибы могут подавлять.Но они отлично сочетаются с пастой, жареными овощами, салатами, стейками, курицей, бараниной и многим другим.


Можете ли вы сделать это веганом?

Да! Вам нужно будет внести всего два изменения, и одно очень незначительное. Во-первых, замените масло, используемое при обжаривании лука-порея, более жирным масляным оливковым маслом (избегайте слишком травянистого или зеленого вкуса). Во-вторых, не кладите сверху козий сыр. Если бы я делал веганский вариант, я бы поджарил, затем раздавил бы несколько кедровых орехов и посыпал их сверху, чтобы добавить немного сочности, но это совершенно необязательно.


Процесс:

Подготовьте ингредиенты. Когда вы все подготовите, самый важный шаг — убедиться, что ломтики лука-порея действительно чистые! Лук-порей может удерживать много грязи между слоями. Убедитесь, что вы разломили слои, и тщательно промойте их в нескольких сменах воды.

Приготовьте лук-порей. Цель состоит в том, чтобы лук-порей стал мягким и на нем развился легкий цвет. Они оставят на сковороде немного помадки (этих красивых подрумянившихся кусочков), что придаст готовому блюду великолепный аромат.Затем добавьте чеснок и немного обжарьте, а затем удалите глазурь с белым вином. Если вы не знакомы с этим термином, он означает использование жидкости для разрыхления этих красивых коричневых кусочков помадки, которые затем можно растереть деревянной ложкой на содержимое сковороды.

Подготовить грибы. Помните, я упоминал, что этот рецепт быстр, потому что есть много возможностей для многозадачности? Это как-раз тот случай. Вместо того, чтобы заранее готовить шляпки грибов, вы будете делать это во время приготовления лука-порея.Удалите стебли и жабры, обрезая и выбрасывая концы каждого стебля. Затем вы смажете каждую шляпку грибов оливковым маслом (внутри и снаружи) и поставьте их в духовку, чтобы запечь.

Подготовить начинку. Пора снова работать в многозадачном режиме! Пока грибы и лук-порей готовятся, измельчите стебли и жабры грибов, которые вы только что вынули из шляпок. Затем вы добавите их к луку-порею. Вы также добавите большинство других ингредиентов. Готовьте смесь несколько минут, чтобы грибы могли выпустить влагу.В этот момент вы добавите рис и, при желании, еще вина. Цель здесь — получить текстуру и уровень влажности, которые вы предпочитаете, так что не стесняйтесь экспериментировать. Вы даже можете добавить больше риса, если хотите, чтобы он был суше!

Закончить грибы. Если после запекания грибы действительно мокрые, смочите лишнюю жидкость бумажным полотенцем. Затем вы заполните грибы рисовой смесью. Я люблю (осторожно!) Открывать крышки, чтобы набить больше, потому что они могут немного сесть в процессе жарки.Затем вы положите сверху каждый козий сыр и снова поставите в духовку на несколько минут. Это все нагревает и дает козьему сыру возможность размягчиться. Затем украсьте и наслаждайтесь!

Совет: , поскольку козий сыр на самом деле не тает, как другие сыры, а просто становится мягким, вы можете осторожно прижать его к фаршированным шляпкам грибов непосредственно перед гарниром и подачей на стол.


Поднимите фаршированные рисом грибы Портобелло на новый уровень:

Трюфельный козий сыр: это очень вкусно, но если вы делаете его как особенное лакомство, подумайте о замене простого козьего сыра на козий сыр с трюфелем.Насыщенная землистость трюфеля усилит грибной вкус и придаст блюду особую выразительность.


Ищете что-нибудь к этим грибам с рисом? Попробуйте мой сливочный суп из орехов и тыквы со сливочным сыром !


Грибы Портобелло, фаршированные рисом

Гретхен

Богатые и сытные с нотками яркости, эти фаршированные рисом грибы портобелло являются идеальной закуской или гарниром (или добавляются в качестве дополнения и служат в качестве основного блюда!).

Время приготовления 5 минут

Время приготовления 25 минут

Порции 4 в качестве закуски или гарнира

Калорийность 299 ккал

Ингредиенты

  • 4 зубчика чеснока
  • ½ стакана вяленых помидоров (около 8 половинок)
  • ½ большого лука-порея
  • 2 столовые ложки сливочного масла
  • кошерная соль
  • ½ стакана белого вина (плюс больше)
  • дополнительно оливковое масло первого отжима
  • 4 шляпки грибов портобелло среднего размера
  • ½ чайной ложки копченого перца плюс дополнительный компонент для гарнира
  • ½ чайной ложки тмина
  • 1 ½ стакана подготовленного / вареного риса (остатки риса отлично подходят!)
  • 4 унции козьего сыра
  • Базилик для украшения

Инструкции

  • Подготовьте ингредиенты. Разогрейте духовку до 400 F (200 C). Линия выпечки с пергаментной бумагой. Измельчите чеснок. Нарежьте вяленые помидоры. Нарежьте лук-порей тонкими ломтиками и хорошо промойте.

  • Приготовьте лук-порей. Растопите масло в большой сковороде. Добавьте лук-порей и ½ чайной ложки соли, затем обжарьте на среднем огне, регулярно помешивая. Через 7-8 минут они должны стать нежными и подрумяниться. В этот момент добавьте чеснок. Готовьте примерно 30 секунд до появления аромата, затем добавьте белое вино и удалите глазурь со сковороды, аккуратно соскребая коричневые кусочки.

  • Подготовьте грибы. Пока лук-порей готовится, выдолбите грибы, удалив стебли и жабры (отложите, не выбрасывайте). Смажьте шляпки оливковым маслом и выложите на подготовленный противень открытой стороной вверх. Выпекать около 15 минут, пока не станет мягким.

  • Подготовьте начинку. По мере того, как грибы запекаются, мелко нарежьте их ножки и жабры. Добавьте к луку-порею вместе с вялеными помидорами, копченой паприкой и тмином.Готовьте на среднем огне, примерно 5 минут, пока грибы не откажутся от сока и не начнут намокать. Добавьте рис и перемешайте. Если смесь выглядит очень сухой, добавьте еще немного белого вина, до стакана. Готовьте смесь пару минут, чтобы она прогрелась. Попробовать и при необходимости посолить.

  • Завершите грибы. Удалите излишки влаги с грибов бумажным полотенцем. Выложите рисовую смесь в грибы и посыпьте каждый 30 г козьего сыра.Верните грибы в духовку и запекайте еще около 5 минут, чтобы прогреть козий сыр. Посыпать копченой паприкой, украсить базиликом и наслаждаться!

Как сделать грибное зерно в домашних условиях

Создание зерновой икры — это этап выращивания грибов, которым может заняться вся семья — работа найдется для каждого.

Этот этап процесса выращивания грибов наступает до того, как вы используете зерновую икру для инокуляции конечного насыпного субстрата, но после того, как вы сделали (или купили) чистую культуру.

Процесс создания зерновых грибов практически идентичен для выращивания всех видов грибов: от жемчужных, королевских, розовых, синих, золотых или белых вешенок до шиитаке, эноки, рейши, пиоппино или львиной гривы.

Вот отличная диаграмма Пола Стаметса, на которой показаны этапы выращивания грибов с выделением подготовки и инокуляции зерновой икры.

Схема из книги Пола Стаметса «Выращивание гурманов и лекарственных грибов» — нажмите, чтобы увеличить

Последний пост в блоге, которым мы поделились Выращивание грибов: пастеризация насыпного субстрата для множества мешков с грибами — этап, на котором вы берете зерновую икру и добавляете ее в субстрат для плодоношения.

Это этап перед этим — процесс создания икры, чтобы инокулировать этот субстрат — солому, щепу или что-то еще, что вы выберете.

Цель зернового нереста — позволить выбранному вами мицелию размножаться в контролируемой среде, прежде чем вы позволите ему высыпаться на плодоносящий (основной) субстрат.

Для этого ваше зерно (в данном случае органическая пшеница) должно быть стерильным. Самый простой способ сделать это для домашнего культиватора — использовать качественную скороварку.

Сегодня мы потратили день на выращивание зерновых, чтобы вырастить много прекрасных грибов.

Мы стараемся не производить отходов при выращивании грибов.

Мы использовали банки, а не одноразовые пластиковые пакеты или контейнеры, поэтому, когда мы узнали о небольшой хитрости по созданию воздушного фильтра для наших банок, нам пришлось попробовать его.

Этот воздушный фильтр обеспечивает некоторый газообмен, предотвращая попадание биологических загрязнителей в сосуды. Это позволяет нашему мицелию дышать, предотвращая попадание любых других грибковых спор, таких как плесень.

  • 12 банок по 500 мл (1/2 кварты или около того) с металлическими крышками
  • небольшая отвертка с крестообразным шлицем или большой гвоздь, молоток и деревянный брусок
  • горстка полифилла (полипропиленовая набивка, используемая в подушках)

Вместо полифилла вы можете использовать что-нибудь еще инертное + пористое, которое не впитывает воду и выдерживает процесс пастеризации, так как вы не хотите добавлять этот элемент впоследствии (из-за очевидных проблем с загрязнением).

  • 12 стаканов (3 литра) органического цельного зерна пшеницы (предварительно замоченного в течение 24 часов в холодной воде)
  • 12 чайных ложек гипса (сульфат кальция — его можно купить в любом садовом центре — иногда продается как «глиняный крушитель»)
  • Ваши 12 банок, как указано выше, с воздушными фильтрами или пластиковыми контейнерами, если вы хотите пойти по этой дороге (см. Дизайн ниже)
  • скороварка

После замачивания зерна в течение 24 часов, мы осушили его на большом дуршлаге, пока не перестанет капать вода, затем подмешали гипс.

Затем мы «взбиваем» зерно в чистые банки, наполняя их на 3/4.

Когда наши банки наполнились и закрылись крышки, мы поместили их все в скороварку с двумя дюймами воды на дне.

Замечание о скороварках — эти штуки — изумительные устройства, но они также, по сути, ждущие парометаллические бомбы, если с ними не обращаться должным образом. Всегда внимательно читайте инструкции к скороварке перед ее использованием.

Поскольку у нас было , мы уже полностью прочитали инструкции по скороварке, мы закрыли ее, включили нагрев и удерживали скороварку при 15 фунтах на квадратный дюйм в течение 2 часов.

Дайте скороварке полностью остыть, прежде чем снимать ее крышку и снимать банки с пастеризованной икрой.

Эти пластиковые контейнеры…

Мы также сделали несколько пластиковых контейнеров с икрой, чтобы потом раздать их студентам — один из наших учеников придумал отличный способ прикрепить полоску бумаги под крышкой каждого контейнера — это предотвращает деформацию контейнеров от жары. скороварки, поскольку она позволяет осуществлять небольшой газообмен, сохраняя при этом содержимое контейнера стерильным.

А теперь самое интересное! После того, как зерно в банках полностью остынет, его возвращают в вашу лабораторию с максимальной стерильностью, чтобы добавить кусочек чашки с чистой культурой в идеально чистую икру.

Теоретически, если все пойдет хорошо, мицелий на этом кусочке чистой культуры затем колонизирует ваше чистое зерно, съедая его.

И через неделю или две (7 дней, если вы можете держать икру при 24 градусах Цельсия) вы должны полностью колонизировать икру.

Для этого сеанса мы использовали культуры пиопино, рейши, жемчуг, король + голубую устрицу, шиитаке и львиную гриву.

Скрестив пальцы, они все счастливо растут.

Колонизированное нерестилище — вы можете увидеть оригинальную полоску агара чистой культуры в пластиковом контейнере посередине, окруженную пушистым здоровым мицелием

Икра вашего зерна на этом этапе должна быть белой и пушистой в банке — это признак здорового, колонизированного икры.

Вообще говоря, белый и пушистый — это хорошо, а синий, розовый или желтый — плохо. Цвета, отличные от белого, указывают на то, что другие споры грибов или бактерии прыгнули и колонизировали ваше потомство.Выкиньте его в компостную кучу и начните заново, если это произойдет — живите и учитесь!

После того, как у вас есть полностью колонизированное зерновое икры, пора пастеризовать некоторый плодовый субстрат (щепа, мульча из сахарного тростника, опилки — точный субстрат зависит от того, что предпочитают питаться ваши грибы) и добавить к нему икры.

Вот пост о создании грибного сада с нерестом — вы можете видеть, что для этой цели использовали большие мешки с нерестом.

И вот перед едой вы перейдете к завершающей стадии размножения грибов! Как хорошо.

Мы проводим курсы по выращиванию изысканных грибов в Сиднее, если вы хотите научиться расти вместе с нами!

Удачи, культиваторы! Пусть вскоре на ваших разделочных досках перед ужином будет полно таких вкусных вешенок, как эта…

Фото № 18, сделанное Натом МакКомасом, с недавнего курса по выращиванию грибов для гурманов — спасибо, Нат!

.

Добавить комментарий

Ваш адрес email не будет опубликован.

Any Queries? Ask us a question at +0000000000